Состав сип: Из чего состоит СИП панель

Содержание

Из чего состоит СИП панель: Составляющие компоненты и преимущества

СИП панель – структурно-изолированная панель. Технология строительства из этого материала появилась в начале 20 века в Канаде для малоэтажного строительства. Сейчас она популярна и в России. Дома из СИП-панелей – это надежные строения с комфортным микроклиматом внутри.

Из чего состоит сип панель? В основе метода – использование панелей, которые состоят из нескольких слоев разных материалов. Благодаря этому они прочны и хорошо сохраняют тепло.

Строение СИП панели

Как устроена СИП панель

Это – разновидность сэндвич-панели, которая состоит из OSB-плит, между которыми находится слой пенополистирола для теплоизоляции.

OSB-плита

Orient Strand Board – ориентировано-стружечная плита. В русском языке можно встретить такие сокращения – ОСБ или ОСП.

Плиты состоят из спрессованных древесных стружек или щепы из хвойных пород, реже из осины, тополя и других деревьев. В отличие от других стружечных плит в ОСП щепа лежит в определенном направлении. В наружном слое – в продольном направлении, а во внутреннем – в поперечном. Благодаря этому достигается высокий уровень прочности.

Чтобы щепа лучше соединилась, ее пропитывают смолами, которые состоят из карбамида, меламина, восков и других компонентов. Смол в составе – менее 10%.

Пенополистирол

Материал расположен в середине SIP-панелей. Он состоит из вспененного и обработанного паром при высокой температуре стирола. Благодаря такой технологии получаются герметичные ячейки. Стенки прочные и водонепроницаемые, не впитывают летучих веществ.

Уровень водопоглощения – 0,4%. Показатель прочности в 5 раз выше пенопласта. Он не рассыпается со временем, достаточно легко гнется, плохо сминается.

Преимущества

  • Благодаря панелям в доме тепло и уютно. Он выдерживает колебания температуры от -50 до +50 °C.

  • Плиты надежно скреплены друг с другом. Дом получается прочным – ОСП выдерживают горизонтальную нагрузку в 2 т, и вертикальную в 10 т.

  • Вес панели 2500*1250*174 – 50 кг. Готовый дом площадью 150 м2 весит около 40 т. Это меньше, чем дом из кирпича или бруса.

  • Для основания подходит облегченный ленточный или свайный фундамент. Для монтажа не нужна тяжелая спецтехника. Достаточно бригады из трех человек.

  • Процесс возведения занимает несколько недель. Большая часть времени уходит на возведение фундамента и каркаса.

  • Толщина панелей для стен дома для постоянного проживания – 174 мм. Вы экономите пространство в помещении.

При строительстве важно доверить работу специалистам. Только в этом случае гарантировано высокое качество.


Использование СИП-панелей для строительства домов

СИП-панели – это современный строительный материал, с успехом применяющийся для возведения частных домов.

Содержание статьи

Свойства и состав SIP панелей

SIP- структурная теплоизоляционная панель состоит из трёх слоёв, внутренний (№1), как правило, полистирол, экструдированный пенополистирол  или пенополиуретан и накладки, внешние слои  (№№ 2,3) – OSB-плиты. Плиты соединены с изоляцией прочным полиуретановым клеем.

Благодаря своей слоеной конструкции панели отлично выдерживают перепады температуры и излишнюю влажность.

Наружная сторона, OSB-плита, состоит из древесной щепы, парафиновой эмульсии и синтетических смол. Все связующие проходят тщательную проверку и являются экологически чистыми материалами.

Благодаря такой конструкции при возведении домов из SIP панелей достигается максимальный уровень теплозащиты.

По внешним сходствам этот материал часто называют сэндвич-панелями. Наружные слои по большей мере предназначены обеспечить стойкость к механическим воздействиям, а внутренний – это утеплитель.

Соединение СИП-панелей происходит методом пазов. С одного торца панели крепится  брус, а с противоположного делается паз для него. Таким образом, панели как бы вставляются друг в друга.

Такое соединение имеет определенные преимущества. Первое из них – это фактическое отсутствие щелей, а второе – деревянный брус дает дополнительную прочность строению, создавая своего рода каркас.

Преимущества домов из SIP-панелей

  1. Материалы, из которых производятся СИП-панели, абсолютно безопасны для окружающей среды и человека.
  2. Итоговая стоимость дома, построенного из сэндвич-панелей, зачастую, значительно ниже, чем аналогичного из кирпича или дерева.
  3. При строительстве из данного материала очень чётко соблюдается геометрия дома. Сами СИП-панели идеально ровные и требуют лишь правильной установки по уровню, тогда как кирпичная кладка, например, намного сложнее в укладке строго по вертикали и горизонтали.
  4. Прочность – ещё одна отличительная черта сэндвич-панелей. Нагрузка в 15 тонн по вертикали и 2,5 тонны по горизонтали позволяет возводить из СИП-панелей даже несущие стены.
  5. Малый вес материала позволяет обойтись без дорогих видов фундамента из железобетона. Также это значительно упрощает процесс монтажа и не требует применения крупной строительной техники.
  6. СИП-панели являются мощным утеплителем, так как обладают низкой теплопроводностью. Это позволяет сэкономить на отоплении и не уменьшать полезную площадь дома за счёт дополнительной внутренней обшивки.
  7. Помимо всего прочего сэндвич-панели – это негорючий материал. В процессе производства все его слои обрабатываются огнестойкими пропитками.
  8. Внешние слои СИП-панелей, сделанные из OSB, обрабатываются специальным влагозащитным составом, предотвращающим промокание материала. Пенополистирол же не подвержен гниению в принципе. Таким образом, стены вашего дома будут защищены от пагубного влияния влаги, грибка и мха.

Также следует упомянуть и о том, что простота и удобство сэндвич-панелей позволяет производить строительство домов с различными архитектурными формами и изысками. Планировка и площадь здания могут быть абсолютно любой, выбор её будет зависеть лишь от ваших желаний и предпочтений, а никак не от того, что позволит материал.

Строительство домов с использованием СИП панелей

Строительство быстровозводимых домов из SIP панелей ведет свое начало из стран Северной Америки и Европы. Каркасное строение из таких панелей отличается энергоэффективностью и теплоустойчивостью. Благодаря высоким показателям экологичности и долговечности постройки каркасно-панельных домов, этот метод стал прекрасной альтернативой возведению домов из кирпича или бревенчатого бруса.

Возведение каркасных домов из панелей

Основным плюсом строительства из SIP панелей является скорость возведения постройки. На сборку одного дома средней квадратуры уходит от одной до двух недель, причем весь процесс происходит прямо на глазах заказчика. Установка строения из SIP панелей отличается своей простотой, поэтому заказчик может приступить к возведению дома самостоятельно, следуя инструкции по сборке.

Панели оборудованы уже готовыми оконными и дверными проемами и не нуждаются в дополнительной обработке. Благодаря отведенному каждой панели месту, сборка дома напоминает конструктор.

Возведение конструкции дома  из SIP панелей начинается с фундамента выполненного столбчатым или свайно-винтовым способом, что предотвращает излишнюю усадку дома. После на конструкцию укладывается материал основу первого этажа, состоящую из гидроизоляционного материала.

После подготовки первого этажа монтируется первая угловая стойка, к которой впоследствии и крепятся наружные стены и перегородки по системе «паз-шип». По завершению монтажа первого этажа, по идентичной технологии выполняют последующие этажи и крыши.

Все перекрытия и OSB панели перекладываются специальным негорючим и экологически чистым утеплителем. Благодаря этой технологии вся конструкция дома не требует дополнительного утепления.

После полного монтажа стен, все поверхности грунтуются, а стыки и швы проклеиваются при помощи армирующей сетки. Фасад такого здания после грунтовки можно покрыть виниловым сайдингом или фактурной краской на выбор.

По завершению основных облицовочных работ необходим монтаж стеклопакетов и их облицовка. В большинстве случаев в качестве кровли для быстровозводимых домов из SIP панелей используется мягкая  или полимерпесчаная черепица.

Дома выполненные из SIP панелей отличаются высокой прочностью, экологической безопасностью и продолжительным сроком службы.

СИП-панели: что это такое - фото домов из SIP панелей, отзывы, плюсы и минусы

Современных стройматериалов для строительства энергоэффективных частных домов по приемлемой цене на рынке имеется немало. И далеко не последнее место среди них занимают СИП-панели. Малоэтажные дома из этого конструкционного материала экономически выгодней бетонных и кирпичных строений. Отзывы о таком жилье их владельцы оставляют на форумах самые положительные. Плюсы его неоспоримы, а минусы в большинстве своем просто мифы.

Содержание

  1. Что это такое
  2. Плюсы и минусы
  • Виды и характеристики
  • Фото домов
  • Что такое SIP-панели?

    SIP-панель (Structural insulated Panel, Структурно-Изоляционная Панель) – многослойный строительный материал из пары древесных плит с утеплителем внутри. Внешние слои этого “сэндвича” выполняются из влагостойких ОСП (OSB), которые обеспечивают ему нужную жесткость. Это позволяет из таких панелей возводить дома в несколько этажей, не усиливая их дополнительными несущими конструкциями.

    Схема устройства SIP-панели

    Самостоятельно сделать подобную плиту с должными характеристиками невозможно. Изготовленные своими руками не по стандартам SIP-панели можно использовать исключительно для обшивки надежного каркаса. Применять их в качестве конструкционного материала для стен дома нельзя.

    После склейки ориентированно-стружечных плит и утеплителя готовую СИП-панель отправляют на стройку либо сразу на фабрике раскраивают под нужные размеры. Во втором случае строители получают набор деталей, из которых надо просто собрать дом как конструктор.

    Схема устройства несущих стен из СИП-панелей

    Главное достоинство этого материала – это высокие характеристики теплоизоляции. При пенополистирольном слое в 100 мм сопротивление теплопередачи у них выше, чем у кирпичных стен толщиной 2 м. Чтобы достичь подобных показателей, пенобетонные или бревенчатые дома должны иметь внешние стеновые конструкции в 50–60 см.

    Возвести коттедж из дерева или кирпича с аналогичными параметрами теплоэффективности возможно. Но у домов из СИП-панелей в таком сравнении есть еще одно преимущество. Их строительство обойдется попросту дешевле. Если конечно не нарваться на излишне предприимчивых строителей с завышенными расценками на панели. Эти за любой дом запросят так будто он золотой. А сами материал при этом закупят дешевый и некачественный.

    Плюсы и минусы СИП-панелей

    Среди достоинств дома из панелей упоминания стоят:

    • Малый вес – квадратный метр структурной плиты с пенополистиролом в качестве утеплителя весит меньше 20-ти кг;

    • Минимальные сроки строительства – дом с мансардой возводится всего за 20–25 дней, уже через три недели можно будет делать на его фоне фото для выставления в соцсетях;

    • Высокая теплоэффективность – плиты стандартной толщины в 17 см достаточно для возведения теплого коттеджа в подавляющем большинстве российских регионов;

    • Повышенная шумоизоляция стен – все используемые при изготовлении стройматериала утеплители отлично препятствуют проникновению в дом уличных звуков;

    • Отсутствие нерабочих сезонов – коттеджи из СИП-панелей можно строить в течение всего года;

    • Предельная простота сборки здания – купленную плиту надо лишь раскроить на нужные детали, а для их монтажа достаточно будет пары человек.

    Она достаточно прочная

    Сделанные по всем нормам технологии панелей устойчивы к плесени и грибку, а также выдерживают значительные поперечные и продольные нагрузки. Для усиления им в торцы вкладывается обычный либо клееный брус.

    Среди недостатков у SIP-панели числятся:

    • Вредность в плане экологии – клеящие составы в ОСП и пластик в утеплителе назвать экологически безвредными сложно;

    • Горючесть – несмотря на антипиренные пропитки дом из этого стройматериала полностью обезопасить от огня не получится.

    Самый большой минус дома из СИП-панелей, как и любого другого деревянного, — это подверженность горению

    Претензии по поводу поселения грызунов в стенах из СИП во многом надуманы. Крысы в частном доме прогрызть могут даже бетонные стены. Утеплитель и плиты из древесной стружки им не помеха. Но вот селиться внутри панели они точно не будут. В пенополистироле есть специальные добавки, которые для них смертельны.

    С пожароопасностью такого строения спорить сложно. Но дом из бревна или профилированного бруса с этой точки зрения тоже назвать полностью безопасным нельзя. Везде, где в качестве стройматериала используется древесина, ее надо обрабатывать антипиренами. Только так можно снизить риски возникновения пожара.

    Отзывы владельцев домов из панелей

    По отзывам хозяев, дом получается теплым и комфортным. Единственная проблема для жильцов – это вентиляция. Подобные коттеджи напоминают термос с герметичными стенками. Вентиляционную систему в них проектировать зачастую приходится принудительную. Естественного притока воздуха не хватает. Стены из SIP его в дом просто не пропускают от слова «совсем».

    Положительные отзывы
    • В 4 раза прочнее деревянно-каркасных; в 2 раза теплее домов из дерева; в 5 раз быстрее в строительстве, чем дома из кирпича и газопенобетона; имеют увеличенную на 12 % полезную площадь при одинаковом пятне застройки; в отличие от каркасных домов не имеют «мостиков холода»; в отличие от газопенобетонных, деревянных и кирпичных домов не дают усадки; в отличие от каркасных и газопенобетонных домов не содержат летучих элементов; не подвержены гниению, поражению насекомыми и значительно меньше каркасных домов поражению грызунами; абсолютно безопасны для человека и окружающей среды легки в отделке, т.к. имеют идеально ровные поверхности стен и углы. © ССергей, forumhouse.ru.

    • Построил каркасный дом с отцом и друзьями за три месяца , третий год стоит, полет нормальный. © Revolt, forum.onliner.by.

    • И я буду сам строить из сип-панелей на курьих ножках (сваях) — строится быстро. а время — деньги. Построй дом из силиката,а потом облепи его пенопластом.чтобы тепло было)) испарений нет? + в фундамент полстоимости дома влить. Только сип. главное приточку и вытяжку грамотно продумать. из чего еще можно построить дом в 120кв за 25-30 тыс? © LANTAN, forum.onliner.by.

    • Строю сип панельные дома с 2010 года в основном в подмасковье, общаюсь с бывшими заказчиками все очень довольны дома теплые, быстро собираются, стены идеально ровные(отделывать любота), за эти годы навозил себе плит и за зиму пока дома собрал себе дом и накрыл. коменты типа развалится пишет тот кто строил из блоков и вбухал кучу бабла времени и нервов. стройте не сомневайтесь быстро недорого тепло надежно. © sanik1975, forum.onliner.by.

    • Не знаю, насколько ЭКО-логично все это, но вполне логично, что те, у кого нет такого дома, настаивают, что такие дома плохи, а те, у кого есть такой — дом — что они хороши. У меня есть! Поэтому я остановлюсь на том, что прежде, чем разрешить эти технологии (особенно за границей) настоящие специалисты этого дела оценили риски. Вообще я стараюсь поменьше думать, как много вредного в нашей повседневной жизни — что мы едим, чем дышим, во что одеваемся, чем пользуемся…. А еще сколько теряем здоровья, конфликтуя (в том числе вируально)
      С нетерпением жду тепла и схода снега на даче, чтобы приступить к отделке нашего такого аккуратненького домика, который ждет, когда мы среди лавины забот выделим ему время…© Лесная дача, dacha.wcb.ru.

    • Согласен, это современная технология, начинали свою деятельность с домов из рубленного бревна, со временем поняли, люди хотят что-то экономичное, быстровозводимое и теплое. Построил один раз и забыл. Никакой конопатки не надо. Есть действительно один минус из сип панелей, плохая шумоизоляция. Но это решается листами гипсокартона при внутренней отделке. © alexandermos77, dacha.wcb.ru.

    Отрицательные отзывы
    • Теперь вы будете знать, что действительно останется от вашего SIP дома в случае пожара. Ничего! На тушение SIP дома, потребовалось 5 машин пожарной службы и 2 машины на утро следующего дня. © ВладимирБаринов, forumhouse.ru.

      Был построен дом 8,5 м х 9,5 м в 2 полных этажа


      Дом подожгли детишки


      Всё сгорело полностью

    • Дома, построенные по этим технологиям стоят 10-20-30 лет, но к сожалению, не здесь, а за рубежом. Наша консервативность в строительстве пока мешает новым технологиям, хотя в других
      сферах мы новые технологии принимаем. © fabhouse, forumhouse.ru.

    • 1. никому не известный уровень неээкологичности. Одни хвалят другие пугают. Стены желательно полностью изолировать от жилого помещения пленкой или гкл или чем то подобным, нейтральным для человека и не пропускающим воздух (это мое мнение а не знание), на пол — стяжка, подвесной потолок и вроде изолировали

      2. звукоизоляция

      3. при пожаре лучше не тушить (если тушим не дышать), это так на минуточку почти всех домов касается кроме средневековых замков

      4. дом не «дышит», нужна система вентиляции или проветривание

      5. Камин можно поставить, но топить скорее всего придется аккуратно. Дом сразу нагреется до высокой температуры, жарко будет, придется окнами регулировать. © a5501040, dacha.wcb.ru.

    • Тут передача по телевизИру была про дома из СИП-панелей. Купленные люди Владельцы очень лестно отзывались о своих приобретениях. Через фразу, слышно словосочетание ЭКО-дом.
      Никто не скажет, почему конструкцию из смолы и фенолов, называют ЭКО-дома? © Маэстро, dacha.wcb.ru.

    Виды и характеристики панели

    Утеплителем в структурных изоляционных панелях может быть:

    1. Пенополистирол.

    2. Пенополиуретан.

    3. Базальтовая минвата.

    При выборе материала сравнивать необходимо все плюсы и минусы этих теплоизоляторов. С точки зрения цены самым дешевым является пенополистирольный вариант. Однако он и первый по горючести. Несмотря на все заверения продавцов о его безопасности в доме из пенополистирола не каждый захочет жить.

    Минеральная вата в отличие от него не содержит формальдегидов и имеет класс пожарной опасности «НГ». Однако она более тяжела по весу. Дому с композитными стенами из нее потребуется несколько более мощный фундамент. Зато в минвате можно без опаски прокладывать кабель-каналы под электропроводку.

    Пенополиуретан наиболее долговечен и обладает наименьшей теплопроводностью из перечисленных утеплителей. Минвата предрасположена к накоплению влаги, но не загорится. Однако классикой SIP-технологии является пенополистирол. С ним производителям проще работать и он недорогой.

    Таблица размеров панелей

    Вид Толщина
    ППС
    Толщина
    OSB
    Толщина Длина Ширина Масса
    SIP-Панель
    2500*1250*118
    100 мм 9 мм 118
    мм
    2500
    мм
    1250
    мм
    42 кг
    SIP-Панель
    2500*1250*124
    100 мм 12 мм 124
    мм
    2500
    мм
    1250
    мм
    53 кг
    SIP-Панель
    2800*1250*124
    100 мм 12 мм 124
    мм
    2800
    мм
    1250
    мм
    60 кг
    SIP-Панель
    2500*1250*174
    150 мм 9 мм 168
    мм
    2500
    мм
    1250
    мм
    45 кг
    SIP-Панель
    2500*1250*174
    150 мм 12 мм 174
    мм
    2500
    мм
    1250
    мм
    56 кг
    SIP-Панель
    2800*1250*174
    150 мм 12 мм 174
    мм
    2800
    мм
    1250
    мм
    63 кг
    SIP-Панель
    2500*1250*218
    200 мм 9 мм 218
    мм
    2500
    мм
    1250
    мм
    48 кг
    SIP-Панель
    2500*1250*224
    200 мм 12 мм 224
    мм
    2500
    мм
    1250
    мм
    59 кг
    SIP-Панель
    2800*1250*224
    200 мм 12 мм 224
    мм
    2800
    мм
    1250
    мм
    66 кг

    Таблица характеристик панелей

    Характеристика Значение Комментарий
    Прочность 1,5 кгс/см² — 1,8 кгс/см² SIP-панель способна выдерживать вертикальную нагрузку до 10 тонн и поперечную — 2 тонны на 1 м² (для строительства коттеджей достаточно 350 кг)
    Объемный вес 25 кг/м³ /35 кг/м³ / 50 кг/м³ Вспененный полистирол
    Теплопроводность пенополистирольные 0,037 -0,04 Вт/(м·°С)
    минераловатные 0,047-0,07 Вт/(м·°С)
    уретановые 0,028 Вт/(м·°С)
    Нарушение геометрии Нет Плита OSB не коробится и не деформируется от перепадов температур, попадания влаги, поскольку состоит из щепы, начисто лишѐнной недостатков цельной древесины. Лущение бревна разрушает взаимосвязи древесных волокон, убирая тем самым внутреннее напряжение.
    Подверженность болезням Нет В состав связующего плиты OSB входит эмульсия воска, избавляющая без всякой дополнительной биозащиты от появления грибка, плесени, воздействия насекомых
    Усадка Отсутствует Сразу после завершения сборки домокомплекта можно приступать к внешней и внутренней отделке.
    Водопоглощение ПСБ 0,5%-2,1%
    OSB3%-12%
    За 24 часа
    Огнестойкость III степень огнестойкости Сдерживания огня в течение 1 часа
    Звукопоглощение 44 Дб при толщине панели 148 мм, 56 Дб — при 188 мм. На примере полистирола весом 25 кг/м³
    Максимальная этажность строения 2 этажа + мансарда

    Фото домов из панелей SIP

    Выбирая данный стройматериал, основное внимание необходимо уделить качеству склейки ОСП с утеплителем. У сделанных недобросовестным производителем панелей клей может быть нанесен неравномерно. А это прямой путь к расслоению SIP-плиты.

    В собранных из СИП-панелей домах самые низкие счета за отопление. Они выигрывают у многих конкурентов и по цене за квадрат. В сравнении с кирпичным или деревянным аналогом экономия составляет около 20–30-ти процентов.

    Такие дома позволяют использование необычной архитектуры


    Отделка дома никогда не выдаст, что дом из SIP


    Дома из панелей популярны за рубежом, особенно в Канаде


    Из этого материала можно строить даже такие огромные дома


    Ещё пример большого дома из СИП-панелей


    Дом был построен из SIP


    Ещё один вариант с отделкой клинкером


    Загородный одноэтажный дом


    Дом в США


    Дом из SIP на побережье


    Аккуратный дачный домик


    Панели необязательно отделывать сразу, зиму они простоят без проблем


    Отделка дома может быть абсолютно любая


    Дом из СИП-панелей можно облицевать кирпичом


    Можно отделывать деревом


    Можно оштукатурить


    Дома из такого материала прекрасно удерживают тепло


    Симпатичный домик из SIP


    Ещё один красивый вариант SIP


    Ровные стены панелей идеальны для отделки

    Читайте также про другие материалы для стен:

    Смотрите также видео о быстром строительстве дома из СИП-панелей:

    Читайте про другие материалы для дома:

    СИП панели - это качественный материал по привлекательной цене

    СИП панели — это строительный материал, произведенный по современной канадской технологии, который приобретает значительную популярность, день ото дня увеличивается количество владельцев качественного, теплого, долговечного жилья. Почему это происходит? По каким причинам массово покупаются дачные домики из СИП панелей, предлагаемые на рынке в виде конструкторов для сборки? Почему строительство из СИП панелей от компании с полным производственным циклом выглядит так привлекательно в разрезе цены? Чтобы получить ответы на эти вопросы, следует узнать, что же такое SIP панели.

    Содержание статьи:

    Технологическая часть

    Говоря с позиции инженера, СИП панели — это трехслойный композит. Они состоят из трех слоев, в центре находится утеплитель, к нему приклеены плиты облицовки. SIP панель прочна и безопасна для здоровья благодаря тому, что в состав входит материал, свойства которого известны, проверены временем, а именно:

    • в роли утеплителя выступает свободно вспененный полистирол. Этот материал на порядок лучше пенопласта, его структура образована сплошными стенками маленьких камер, в которых запечатан воздух. В них нет микропор, поэтому пенополистирол не впитывает влагу, непроницаем для пара и газов. Данный материал не рассыпается на гранулы, как пенопласт. В качестве утеплителя отдельных сортов СИП панелей может выступать вспененный пенополиуретан, который гораздо дороже, но обладает улучшенными характеристиками, в частности, способностью нейтрализовывать звуковые колебания;
    • в роли отделки классические SIP панели используют ориентированную стружечную плиту. Данный материал обладает высокой прочностью, долговечен, не выделяет вредных веществ. Связующим компонентом выступает смола, которая выделяется из дерева при воздействии высокого давления и температуры.

    Соединяются все три слоя композита с помощью специального клея, который при взаимодействии с водой полимеризуется, при этом глубоко проникая в структуру материалов. Он полностью безопасен для здоровья человека. Клей сертифицирован во множестве стран, проводились сотни исследований. Специальная технология нанесения гарантирует полное покрытие поверхности, в результате чего при соединении трех слоев образуется практически монолитный материал, его прочность позволяет выдерживать вес автомобиля.

    Как это сделано

    Изготовление СИП панелей проходит в условиях промышленного производства. На подающий стол укладывается ОСП, материал покрывается клеем специальными разбрызгивателями. Сверху помещается пенополистирол. После обрызгивания и его клеевым составом, устанавливается вторая облицовочная плита. После этого полуфабрикат SIP панели поступает в промышленный пресс.

    Комплектация многих современных установок для изготовления композитов включает датчики контроля влажности и давления. Автоматика выдерживает SIP панель ровно столько времени, которое требуется клею для завершения процесса полимеризации, учитывая зафиксированные параметры микроклимата. При этом пресс развивает усилие в 20-30 тонн.

    Стандарты качества и характеристики панелей

    К сожалению, не всегда комплектация компонентов для изготовления СИП панелей соответствует тем критериям, которые задает отраслевой стандарт. В Российской Федерации существуют нормы ГОСТ. Они предписывают использовать пенополистирол плотностью 25 кг на кубометр и ОСП плиты с толщиной не менее 9 мм.

    Но на массовом рынке можно найти откровенно некачественный строительный материал. Это SIP панели с рекордно низкой ценой, которая получается при использовании пенопласта в качестве утеплителя. Такой материал не рекомендуется использовать для строительства дома, поскольку он менее долговечен, прочность композита несравнимо ниже, вдобавок, имеет потенциально опасные свойства.

    Большинство производителей поддерживают единый стандарт в разрезе размеров готовой СИП панели. Материал имеет следующие характеристики:

    • размеры 2500(2800) в длину, толщина 1250 мм, от выбора конкретной геометрии зависит, грубо говоря, высота потолков;
    • слой пенополистирола не менее 100 мм;
    • толщина ОСП не менее 9 мм.

    Если рассматривать российский стандарт и SIP панели, свойства которых ему соответствуют, плиту, имеющую типовые размеры, характеризует вес от 39 до 44 кг. Это самый легкий и тонкий материал, из которого делают межкомнатные перегородки дома.

    На рынке присутствуют и другие классы СИП панелей для строительства дома, не всегда входящие в рекомендуемый стандарт по показателям. Основная разница в применяемом пенополистироле. Присутствуют продукты производства Германии с плотностью от 15 кг на кубометр. У него незначительно ниже теплопроводность, но гораздо меньший вес. Применение подобных утеплителей связано с желанием снизить вес конструкций дома, получить запас показателей при строительстве фундамента.

    Преимущества строительства из композита

    Чтобы понять, чего можно достичь, если сделать дом из СИП панелей, кратко перечислим основные преимущества канадской технологии.

    1. Жилье имеет малую массу. Вес SIP панелей дает возможность работать вручную без применения специального подъемного оборудования. Масса дома в сборе такова, что в большинстве случаев не приходится делать сложный фундамент. Для сравнения, конструкция из СИП, жилье большой площади, имеет средний вес 15-25 тонн. Такой показатель недостижим для кирпича и бетона. Похожий вес может иметь только одна железобетонная конструкция, например, стена дома.
    2. Прочность СИП панелей такова, что в малых зданиях (гаражах, бытовках, складах) можно обойтись без силового каркаса. Делается чертеж, по которому элементы просто соединяются между собой, затем поверх стен монтируется обвязка и кровля.
    3. Теплопроводность СИП панелей мала. Для сравнения можно привести следующие цифры: толщина композита в 175 мм означает, что он будет сохранять столько же тепла, сколько полуметровая кирпичная стена. При этом вес конструкции из SIP панелей просто несопоставимо мал.
    4. Единый стандарт соединения, которому подчиняются элементы дома из СИП панелей, делает возможным производство самостоятельного проектирования. Пристройка из СИП панелей своими руками, например, весьма легкая задача, конструкция проста, чертеж можно составить буквально на листе бумаги.
    5. Различный состав композита позволяет использовать те или иные материалы там, где они покажут лучшие характеристики. К примеру, комплектация элементов для создания ангара оптимальна с использованием отделанных металлом панелей. А магнезитовые плиты покажут лучшие результаты в зонах, где сейсмические характеристики местности не позволят строить дома из классических материалов.
    6. Жилье можно приобрести в виде домокомплекта, комплектация которого включает все необходимые элементы для сборки здания. При этом все работы можно провести своими руками. Многие компании по строительству домов из СИП панелей предлагают жилье площадью до 100 квадратных метров, в том числе, в виде домокомплектов.
    7. Конструкции, в состав которых входят SIP панели, отличаются огромным сроком службы. Первые построенные по канадской технологии дома стоят более 70 лет без потери свойств, чего никак не скажешь о панельных, деревянных и даже кирпичных строениях.

    Фактически, перечислять преимущества, которые предлагает СИП панель, можно очень долго. Каждый аспект строительства покажет положительные стороны и выгоды применения современного композита. Дома, построенные с применением канадской технологии, не имеют серьезных недостатков. Есть отдельные факторы, которые стоит учитывать при проектировании, требующие специального внимания. Однако при рациональном подходе – недостатки технологии сводятся к нулю.

    Facebook

    Twitter

    Вконтакте

    Google+

    Самонесущие изолированные провода (СИП)

        Все марки проводов СИП необходимо использовать строго по назначению. Следует точно подбирать арматуру для крепления проводов и ответвлений от магистрали для каждой конкретной марки провода.

        Недопустимо использовать для ВЛ вместо проводов СИП-2 провода СИП-4. Например, при попытке замены провода СИП-2 3х25+1х54,6 -0,6/1 (проводник 54,6 – нулевой несущий из алюминиевого сплава) проводом СИП-4 4х25 – 0,6/1 (используя при этом узлы крепления для провода СИП-2 и одну жилу СИП-4 в качестве нулевой несущей) прочность при растяжении несущей жилы уменьшается почти в 6 раз. В 2 раза за счет снижения сечения проводника и в 3 раза за счет использования в качестве несущей жилы проводника из алюминия, вместо проводника из алюминиевого сплава.  Срок службы такой сети – до первого серьезного обледенения проводов при значительной ветровой нагрузке.

        В городской застройке чаще используют провода СИП-2, так как они не содержат не изолированных жил и позволяют проще обеспечить сближения с инженерными сетями. При прокладке проводов СИП по фасадам зданий необходимо обеспечить расстояние от стен не менее 60 мм (п. 2.4.60 ПУЭ).

        В статье дано лишь общее описание самонесущих изолированных проводов. Для получения более полного представления об этих проводах следует изучить указанные в статье нормативные документы. Также могут оказаться полезными инструкции РД 153-34.0-20.408-97 «Правила приемки в эксплуатацию воздушных линий электропередачи напряжением 0,38 кВ с самонесущими изолированными проводами» и РД 153-34.3-20.671-97 «Типовая инструкция по эксплуатации воздушных линий электропередачи напряжением 0,38 кВ с самонесущими изолированными проводами».

    На рис. 1 показана сеть наружного освещения, выполненная проводами СИП-2. На Рис. 2 показана подвеска провода СИП-2 за нулевую несущую жилу. На рис.3 – провод СИП, проложенный по фасаду здания.

     

    Сеть наружного освещения

    Рис.1 Сеть наружного освещения

     

     

    Рис. 2 Крепление СИП-2 за нулевую несущую жилу

     

    Рис.3 Прокладка СИП по стене

     

    ПРИМЕЧАНИЕ

        До введения в действие ГОСТ Р 52373-2005 кабельные заводы выпускали СИП на номинальное напряжение 0,6/1 кВ по  ТУ16.К71-268-98. Эти технические условия соответствовали финскому стандарту HD626s1. Провод имел марку «Аврора». В Таблице 2 показаны конструктивные особенности проводов «Аврора».

    Таблица 2

    Марка провода

    Напряжение, кВ

    Конструкция провода «Аврора» по ТУ16.К71-268-98

    СИП-1

    0,6/1

    С неизолированной нулевой несущей жилой. Изоляция проводов - светостабилизированный термопластичный полиэтилен

    СИП-1А

    0,6/1

    С изолированной нулевой несущей жилой. Изоляция проводов - светостабилизированный термопластичный полиэтилен

    СИП-2

    0,6/1

    С неизолированной нулевой несущей жилой. Изоляция проводов - светостабилизированный сшитый полиэтилен

    СИП-2А

    0,6/1

    С изолированной нулевой несущей жилой. Изоляция проводов - светостабилизированный сшитый полиэтилен

     

        С появлением ГОСТ Р 52373-2005 в обозначения самонесущих проводов была внесена существенная путаница. Как результат, до сих пор (спустя 7 лет после введения ГОСТ Р 52373-2005) можно встретить провода СИП с одинаковым названием, но разной конструкцией жил. Например, в продаже можно встретить провод СИП-2 как с изолированной (в соответствие с ТУ 16-705.500-2006), так и с не изолированной нулевой несущей жилой (в соответствие с ТУ16.К71-268-98).  Дело усугубляется еще и тем, что во многих справочниках и каталогах, а также в интернете, для многих главном источнике информации, можно увидеть статьи про СИП с давно устаревшей информацией десятилетней давности.  

    21.05.2014 г.

    К ОГЛАВЛЕНИЮ (Все статьи сайта)

    SIP телефония


    В этой статье мы поговорим с вами про SIP-телефонию: вспомним историю её появления, принципы работы, а также подробно остановимся на преимуществах и недостатках SIP телефонии для офиса и для дома по сравнению с традиционным протоколом H.323.

    К концу XX века доставку информации массовому потребителю обеспечивали две «однонаправленные» телекоммуникационные технологии – радио- и телевещание и две «двунаправленные» (интерактивные) – телефония (проводная и беспроводная) и взаимный обмен по сети алфавитно-цифровыми данными, выраженными с помощью двоичного кода. Однако начавшее в то же время свое бурное развитие телекоммуникационное «чудо» – Интернет (и породившее SIP телефонию), постепенно вбирало в себя функции всех этих технологий.

    При этом, хотя потери качества звука и изображения в интернет-радио- и телетрансляциях довольно ощутимы, по сравнению с качеством, обеспечиваемым традиционными технологиями, объемы продаж на мировом телерадиорынке год от года становятся все ниже и ниже. Во втором же сегменте слияние интерактивных технологий привело к существенному оттоку абонентов в офисах и дома от традиционной телефонии в SIP-телефонию и «недополучению» доходов операторами мобильной связи из-за того, что интернет-телефония за сервисы, предоставляемые как стационарной, так и сотовой связью, предлагает потребителям более низкие тарифы, а в ряде случаев – «нулевые»!

    И здесь уместно задать вопрос: «Как удалось создать технологию, реализующую передачу и цифровых данных, и голоса?»

    Отвечая на него, стоит отметить, что об инновационном прорыве в этой сфере говорить не приходится, поскольку речевой трафик просто был «вписан» в хорошо развитую технологию, основанную на коммутации пакетов данных (напомним, что в традиционной телефонии голос передается по сетям с коммутацией каналов). Причем для решения «узловых» задач IP-телефонии используется широко распространенное серверное оборудование, работающее, например, в центрах обработки данных. И вследствие такого «счастливого стечения обстоятельств», создание аппаратного сегмента IP-телефонии для офиса и для дома ограничилось достаточно простой задачей – проектированием и производством терминальных устройств: IP-телефонов, VoIP-шлюзов и т.д.


    Дата-центры, наряду с обеспечением обработки и хранения больших массивов данных, предлагают также услуги веб-хостинга и SIP-телефонии.

    А вот программистов ожидал более сложный и трудоемкий путь: разработка ПО, поддерживающего речевой трафик в среде передачи данных. Задача заключалась в создании протоколов, определяющих алгоритмы работы с голосовой информацией на различных уровнях телекоммуникационной инфраструктуры.

    Главными требованиями, предъявляемыми к этим программным продуктам, были: во-первых, простота интеграции в уже работающие сети и, во-вторых, возможность расширения функциональности протоколов, не требующая утверждения их новых версий центрами по сертификации ПО (довольно длительной процедуры).


    SIP телефония: как все начиналось

    Эти и другие «начальные условия», менее важные, но все же необходимые для обеспечения эффективной работы IP-сети, были удовлетворены в системе программного обеспечения, включающей в себя протоколы пяти уровней: прикладного, транспортного, сетевого, звена данных и физического.

    Протокол первого уровня (прикладного) должен обеспечивать соединение абонентов голосовой связи и его отключение. А также осуществлять еще какие-либо модификации соединения (например, подключение «дополнительных» абонентов). На этом его «обязанности» заканчиваются.

    С технической точки зрения такая функциональность кажется смехотворно простой: ну, подумаешь, «включил тумблер – выключил тумблер». Но не будем делать скоропалительных выводов. Попробуем разобраться в «служебных действиях» ПО, управляющего соединением и разъединением абонентов.

    Первым программным инструментом, осуществляющим такую функцию в IP-телефонии, стал стандарт H.323, изначально предназначенный для работы в сетях Ethernet. Однако его функциональность не могла полностью удовлетворить потребности IP-телефонии. И тогда (а было это на рубеже прошлого и нынешнего веков) «рядом» с ним в IP-сетях начал свою деятельность протокол инициирования связи – Session Initiation Protocol (SIP), при разработке которого программистами был учтен опыт эксплуатации H.323. Так появился термин SIP телефония, то есть телефония на основе SIP протокола.


    SIP протокол предназначен для организации сеанса связи, который будет выполнен (после соединения абонентов) под управлением протоколов других уровней: транспортного, сетевого, звена данных и физического.

    Рекомендации H.323 до сих пор используются в стационарной телефонной связи, поскольку она в настоящее время в основном базируется на сети ISDN (Integrated Services Digital Network), поддерживающей функциональности стационарной телефонии и передачи данных. SIP же востребован интернет-провайдерами, поскольку для них IP-телефония – это один из предлагаемых интернет-сервисов. Поэтому H.323 и SIP еще долго будут мирно сосуществовать и даже работать «плечом к плечу» в сетях, встречаясь в шлюзах-посредниках.

    Но все же, и вендоры, и эксперты мирового рынка IP-телефонии признали, что для этого телекоммуникационного направления протокол SIP – основной и, подчеркивая его значение, выделили отдельный сегмент - SIP-телефонию, темп роста которой, как они считают, в ближайшие годы будет превышать соответствующий показатель для рынка IP-телефонии в целом.


    SIP телефония: архитектура протокола

    Базовый принцип работы протокола SIP – «запрос – ответ» –заимствован из веб-протокола HTTP (Hypertext Transfer Protocol). Кроме того разработчики ПО при создании SIP «перенесли» из HTTP синтаксис (текстовый формат сообщений) и клиент-серверную архитектуру, основным функциональным компонентом которой является абонентский терминал или SIP-клиент, осуществляющий инициирование и завершение вызовов. В минимальной конфигурации к SIP-клиенту подключены три сервера: 1) прокси-сервер (маршрутизация звонков и управление приложениями), 2) сервер переадресации (перенаправление звонков), 3) сервер регистрации (запись абонентов в базу данных, отслеживание соответствия имен абонентов их адресам, телефонным номерам и другим «пунктам привязки»).


    SIP-телефоны (IP-телефоны), VoIP-шлюзы, программные приложения (софтфоны) для ПК и коммуникаторов – все эти устройства приходят в офис и в дом с появлением SIP телефонии.

    SIP-архитектура содержит также комплект ПО, включающий четыре программных модуля: 1) протокол резервирования ресурсов, 2) транспортный протокол реального времени, 3) протокол передачи потоковой информации в реальном времени, 4) протокол описания параметров связи. При необходимости в состав SIP-архитектуры вводятся дополнительные протоколы, но работа всего «сопутствующего» ПО никоим образом не отражается на функциональности SIP.


    Преимущества SIP телефонии перед Н.323

    Для создания общего представления о функциональности и особенностях SIP телефонии приведем «штрихи к профессиональному портрету» в виде списка, сравнивая (где есть возможность такого сравнения) с соответствующими характеристиками Н.323.

    1) Использование текстового формата предоставляет возможность простого анализа записей и сообщений, генерирования кода и эксплуатационного управления протокола, его реализации на любом языке программирования. – В Н.323 сообщения описываются с использованием бинарного кода, что создает трудности при их описании и чтении (для кодирования и декодирования требуется применение компилятора ASN.1).

    2) Взаимодействие с приложениями IP-сетей и поддержка мобильности абонентов обеспечивается использованием адреса, образцом для которого послужил адрес, описанный в протоколе передачи электронной почты SMTP (Simple Mail Transfer Protocol).

    3) Возможно назначать приоритеты в обслуживании вызовов. – В Н.323 такая функция не предусмотрена.

    4) Время установления SIP-соединения примерно в три раза меньше, чем соединения по стандарту Н.323.

    5) Абоненты могут изменять свое местоположение в SIP-сети без ограничений благодаря присвоению им уникальных идентификаторов.

    6) Возможна совместная работа с другими протоколами IP-телефонии, телефонных сетей общего пользования (ТСОП), а также применение для связи с интеллектуальными сетями.

    7) Для взаимодействия с ТСОП, использующими ОКС-7 (ОбщеКанальную Сигнализацию №7), имеются модификации протокола – SIP-T и SIP-I.

    8) Возможно дополнение новыми функциями посредством введения новых заголовков и сообщений. При этом если SIP-устройству попадается неизвестное расширение, то в таком случае оно просто игнорируется. При использовании H.323 неизвестные функции могут «поставить устройство в тупик» и, соответственно, стать причиной отказа в предоставлении сервиса.

    9) Возможно увеличение количества SIP клиентов при расширении SIP сети (масштабируемость).

    10) Безопасность. Шифрование трафика осуществляется на транспортном уровне по протоколу TLS (Transport Layer Security), который применяется вместо TCP/UDP. Могут использоваться также стандарты SIPS (SIP Security) и SRTP (Secure RTP).


    Пример реализации SIP телефонии в офисе.

    Смотрите также:


    Экологическая безопасность SIP-панелей

    Компания TERMOVILLA  не стоит на месте в вопросах повышения экологичности технологии SIP! Мы проявляем индивидуальную заботу о каждом нашем клиенте! Именно поэтому мы постоянно проводим различные исследования в этом направлении, и сегодня у нас есть замечательное решение для тех, кто, в силу своего здоровья, вынужден искать только натуральные материалы в составе всего, что его окружает!

    Для повышения экологичности технологии SIP наша компания разработала специальный состав для внешней обработки OSB панелей. Такую «заботливую» технологию Вы найдете только у нас, ни одна компания на рынке, на сегодняшний день, не имеет подобного решения! Это ноу-хау грунтовка создана на основе нанотехнологий – то есть технологий будущего.

    Что Вы получаете при использовании этого уникального состава:

    • Экологичность в 10-15 раз выше! Применение данной грунтовки позволяет полностью предотвратить выделение в воздух помещений дома паров фенола, снизить в 10-15 раз выделение паров формальдегида.

    • Широкий выбор декора! Защитно-детоксицирующие свойства грунтовки сочетаются с возможностью декоративной отделки поверхностей. После высыхания грунтовки на нее могут наноситься любые краски или приклеиваться любые иные материалы.

    • Экономия! После нанесения состава уже не требуется предварительная грунтовка поверхности перед отделкой помещений. Так, повышая экологичность своего дома - Вы экономите на внутренней отделке.

    • Повышение пожаростойкости поверхности! Покрытия, образуемые составами этой грунтовки, не горят, не разрушаются при действии пламени, по огнезащитной эффективности относятся к 1 группе (средства обеспечивают получение трудно сгораемой древесины).

    • Простота использования и хранения! Грунтовка готовится в виде пасты, стабильной при хранении. Нанесение грунтовки на поверхности может осуществляться при помощи штапеля.

    • Полная безопасность! Грунтовка нетоксична, взрыво-, пожаробезопасна, не оказывают воздействия на кожу.

    2 июля 2014, мы провели экспертизу нашего демонстрационного дома из SIP панелей, предварительно обработанного данным составом, и на деле убедились в том, что такой способ обработки технологии SIP работает на все 100%! Грунтовка, действительно, устраняет все запахи  и испарения в помещении, позволяет сделать дом на столько экологичным, что даже аллергик сможет комфортно себя чувствовать в таком доме.

    В жилищном строительстве можно выделить несколько факторов безопасности:

    • Пожарная безопасность. Достигается с помощью покрытия огнезащитным составом несущих конструкций дома (каркаса, стропильной системы, перекрытий).
    • Физическая безопасность. Предполагает наличие высоких эксплуатационных параметров. Материал должен быть надёжным, долговечным, не скапливать статическое электричество.
    • Экологическая безопасность. Включает химическую и биологическую безопасность используемых материалов. Все материалы, используемые при строительстве и отделке, не должны выделять в воздух вредных веществ. Биологическая безопасность предполагает отсутствие биологической угрозы здоровью и жизни человека — материал должен препятствовать образованию плесени, грибков и размножению болезнетворных микроорганизмов.

    Если пожарной и физической безопасности уделяли должное внимание всегда, то экологическая нередко отступала на второй план, а то и вовсе игнорировалась. В наши дни экологическая безопасность всё чаще становится одним из главных критерием при оценке материалов.

    В США, Канаде и Западной Европе SIP-панели пользуется большой популярностью, в том числе, благодаря их экологичности. Очевидно, что речь идет о странах, где десятилетиями действуют высокие стандарты в сфере экологической безопасности, а потребители привыкли делать осознанный выбор. Помимо жилищного строительства, в указанных странах СИП-панели часто используют при строительстве сооружений, к которым предъявляются особые требования: больниц, детских и культурных учреждений. Важно отметить и то, что многие люди, страдающие астмой и аллергией, предпочитают жить в домах, построенных по канадской технологии.

    Только факты

    Чтобы убедиться в том, что СИП-панели экологически безопасны, рассмотрим с этой точки зрения материалы, из которых их делают.

    • ОСП. Используемая в производстве СИП-панелей плита OSB или ориентированная стружечная плита появилась более 30 лет назад. Она была создана специально для применения в жилищном строительстве, где с успехом и применяется по сей день. Хорошо известные ДСП советских времён содержали такие явно не полезные для здоровья вещества как фенол и формальдегид. Однако с тех пор изготовители стройматериалов научились изготавливать древесно-стружечные плиты, не опасные для здоровья человека, с эмиссией формальдегида класса Е1. А плиты OSP-3, из которых сегодня делают SIP-панели, содержат ничтожно мало связующего вещества, даже по сравнению с современными ДСП. Это фактически такая же «улучшенная древесина», как фанера или клееный брус.

    Следует отметить то, что формальдегид — вещество, которое имеется в составе многих природных материалов, даже такого эталона экологичности, как древесина. Однако разные материалы выделяют его по-разному. Тем материалам, которые практически не выделяют формальдегид, класс безопасности не присваивается вообще, либо присваивается высший класс — E0. Внимание при строительстве следует уделять не только материалам для основных конструкций, но и всем остальным — краске, напольному покрытию, обоям, МДФ. Опасность могут представлять также и предметы мебели. Поэтому желательно удостовериться, что строительные материалы соответствуют европейскому классу безопасности Е1 и Е0. Материалы класса Е1 и Е0 можно без опасений использовать в жилых помещениях, для изготовления детской мебели и т. д.

    Количество формальдегида, который испаряет современная плита OSB, используемая в производстве СИП-панелей, не достигает 0,1 ppm (т. е. 0,1 частей на миллион). Кстати, это значительно ниже уровня, допустимого российскими стандартами при изготовлении детской мебели. Это так мало, что эмиссию формальдегида не могут обнаружить даже многие измерительные приборы. В производстве этих плит применяются смолы, в состав которых, кроме собственно смолы, входят только наполнитель и отвердитель, а процесс полимеризации заканчивается сразу же после завершения прессования.

    Вывод: панели, сделанные с использованием качественных современных ОСП, представляют собой экологически чистый и безопасный строительный материал. 

    • Пенополистирол. Вторым компонентом, входящим в конструкцию СИП-панели, является пенополистирол. Сегодня во многих странах мира пенополистирол признаётся одним из наиболее экологичных материалов, используемых в малоэтажном строительстве. Материал имеет высокий экологический рейтинг, а утепление 8 из 10 европейских домов производится с его помощью. В Японии пенополистирол даже считают «четвёртым поколением конструкционных материалов», применяемых в строительстве жилых домов, наравне с деревом, бетоном и металлом. Пенополистирол широко используется во всем мире при изготовлении игрушек, упаковки продуктов питания, медицинских материалов и т. д. То есть в тех областях, где просто невозможно использование материалов, безопасность которых вызывает сомнения.

    Вывод: пенополистирол, используемый для тепло- и звукоизоляции в СИП-панелях совершенно безопасен для здоровья.

    Мы уделяем повышенное внимание всем факторам безопасности:

    • Повышенная пожарная безопасность. Мы обрабатываем все несущие конструкции огнезащитным составом для придания им категории огнеупорности Г1.

    • Физическая безопасность. Все конструкции тщательно проверяются специалистами TERMOVILLA на прочность в ходе строительства, а также после завершения работ по возведению дома.

    • Экологическая безопасность. В процессе строительства домов из СИП-панелей мы используем инновационный состав для обработки строительных материалов. Применение данного состава увеличивает уровень экологической безопасности СИП-панелей.

    • Компания TERMOVILLA — полная безопасность вашего дома!  Будьте уверены в своем выборе!

    грифов мира гид | BBC Wildlife

    Как называется собирательное слово «стервятники»?

    Стервятники - общительные существа и часто рассматриваются как коллективная единица, но название, присвоенное группе стервятников, зависит от того, что они делают в данный момент.

    Как и большинство птичьих групп, стервятников можно назвать стадом, хотя их также можно обозначить как место встречи, вольт или комитет. Однако, когда дело доходит до группы стервятников, питающихся вокруг туши, их называют следом, а когда птицы летят, их называют котелком.


    Сколько существует видов стервятников?

    Помимо Австралии и Антарктиды, по крайней мере, один вид грифов обитает на любом континенте мира.

    Всего существует 23 различных вида стервятников, однако они классифицируются в зависимости от того, относятся ли они к видам стервятников Нового Света (встречаются в Северной и Южной Америке и Карибском бассейне) или к видам стервятников Старого Света (которые обычно встречаются в Африке, Азии, а также в Европе. ).

    Евразийский гриф, питающийся тушей.© Сильвен Кордье / Getty


    Находятся ли под угрозой исчезновения стервятники?

    Из 23 существующих видов стервятников более половины считаются находящимися под угрозой исчезновения, находящимися под угрозой исчезновения или находящимися на грани исчезновения в результате антропогенного воздействия. Помимо ударов током и отравления от туш браконьерских животных, стервятники также сталкиваются с такими проблемами, как фрагментация среды обитания и рост числа конфликтов между людьми.


    У какого стервятника самый большой размах крыльев?

    Андский кондор - самый крупный из всех видов стервятников, его размах крыльев равен почти 3.5 метров в диаметре! При весе до 15 килограммов андский кондор использует потоки воздуха и тепловые потоки воздуха (в зависимости от их местоположения), чтобы удерживать свои тяжелые тела в полете.

    Андский кондор имеет размах крыльев почти 3,5 метра. © Поль Гатиус / EyeEm / Getty


    Могут ли стервятники петь?

    Стервятники Нового Света не умеют петь песни, как многие другие виды птиц. Вместо этого они ограничиваются простыми звуками, такими как ворчание и шипение.


    Стервятники едят только мясо?

    Хотя кости по большей части составляют рацион стервятника, есть некоторые виды, которые предпочитают более сбалансированную диету. Питаясь разнообразными орехами, рыбой и другими птицами, и гриф из пальмового ореха, и стервятник с мордочкой преуспевают, чтобы бросить вызов своим навязчивым стереотипам.

    Пальмовый гриф питается в основном плодами масличной пальмы. © Education Images / Getty


    Как стервятники сохраняют хладнокровие?

    «Урогидроз» - это процесс, при котором животное мочится на себя, чтобы охладиться, когда температура достигает невероятно высокой температуры.Однако стервятники также используют эту технику для дезинфекции своих ног от бактерий после кормления гнилыми тушами, поскольку их моча содержит высокий уровень кислоты.


    Как стервятники могут переваривать кости?

    Помимо мочи, в желудке стервятников содержатся очень сильные кислоты. Эти кислоты не помогают птицам бороться и уничтожать смертельные бактерии, но также помогают разрушать кости туш, которые поедают птицы, которые составляют от 70 до 90 процентов их общего рациона.

    Стая кружащихся индюков. © EzumeImages / Getty


    Как стервятники находят трупы, чтобы ими питаться?

    Несмотря на сказки, стервятники не обладают шестым чувством, чтобы обнаруживать или обонять умирающих животных. Кружащиеся стервятники на самом деле исследуют районы в поисках пищи и используют другие органы чувств, чтобы замечать, обнюхивать или слышать других птиц, питающихся тушей, чтобы они могли заполнить свои пустоты до того, как хищники настигнут их.


    Насколько важны грифы?

    Стервятники играют жизненно важную роль в очистке окружающей среды, в которой они живут.Их методы уборки мусора, которых часто называют «отрядом уборщиков природы», помогают предотвратить распространение болезней, таких как бешенство и туберкулез, путем расчистки трупов.


    Как высоко могут летать грифы?

    Термальные воды помогают этим птицам достигать невероятных высот, большая часть которых была бы смертельной для других видов птиц. Серия сердечно-сосудистых адаптаций означает, что стервятники могут летать на высоте, где уровень кислорода минимален, а у одного грифона Руппелла он достигает почти 11.5 километров!

    Белоголовый стервятник Руппелла был зарегистрирован на высоте почти 11,5 километров. © Джеймс Уорвик


    Международный день распространения информации о стервятниках

    Из-за угроз, с которыми сталкиваются стервятники, первая суббота сентября теперь посвящена празднованию Международного дня распространения информации о стервятниках. Эти дни чрезвычайно важны для ознакомления людей с истинной природой этих уязвимых животных, позволяя им одновременно участвовать в веселых занятиях.

    Основное изображение: След стервятников вокруг туши. © Крис Минихейн / Гетти

    Падение мертвых: причины и последствия сокращения популяции стервятников во всем мире

    Стервятники - самые успешные падальщики природы, и они предоставляют множество экологических, экономических и культурных услуг. Как единственные известные облигатные падальщики, стервятники уникально приспособлены к образу жизни падальщиков.Уникальные приспособления стервятников включают стремительный полет, острое зрение и чрезвычайно низкий уровень pH в их желудках. В настоящее время 14 из 23 (61%) видов стервятников во всем мире находятся под угрозой исчезновения, и наиболее быстрое сокращение произошло в богатых стервятниками регионах Азии и Африки. Причины сокращения популяции разнообразны, но отравление или преследование людей, или и то, и другое, фигурируют в списке почти каждого исчезающего вида. Умышленное отравление плотоядных животных, вероятно, является наиболее распространенной причиной отравления стервятником.В Азии численность грифов сократилась более чем на 95% из-за отравления ветеринарным препаратом диклофенак, который был запрещен региональными правительствами в 2006 году. Преследование стервятников людьми происходило веками, а стрельба и умышленное отравление являются наиболее распространенными видами деятельности. Экологические последствия исчезновения стервятников включают изменения в составе сообщества падальщиков на тушах и повышенный потенциал передачи болезней между падальщиками трупов млекопитающих. Сокращение стервятников привело к культурным и экономическим издержкам, особенно в Азии.После катастрофического спада стервятников в Азии региональные правительства, международное научное сообщество и сообщество доноров, а также средства массовой информации уделили кризису значительное внимание. Несмотря на то, что кризис азиатских стервятников привлек внимание к тяжелому положению стервятников во всем мире, ситуации с африканскими стервятниками уделялось относительно мало внимания, особенно с учетом аналогичных уровней сокращения популяции. В то время как азиатский кризис в значительной степени был связан с отравлением диклофенаком, сокращение популяции стервятников в Африке вызвано множеством причин, которые затруднили сохранение существующих популяций.А в Африке правительство мало поддерживало сохранение стервятников, несмотря на растущее количество свидетельств об основных угрозах. В других регионах с успешными программами сохранения стервятников общей темой являются огромные вложения финансовых ресурсов и высококвалифицированного персонала, а также политическая воля и поддержка сообщества.

    Nerding Out с музыкальным руководителем Гамильтона Алексом Лакамуаром

    Фото-иллюстрация: Фото Сары Крулвич / The New York Times / Redux

    11 января - день рождения Александра Гамильтона.Вместо торта на 261 свечу мы празднуем недельный пакет, посвященный постановке и значению одноименного бродвейского мюзикла Отца-основателя.

    Каким образом Беркли на полпути к EGOT в конечном итоге играет на клавишных, отдавая дань уважения плавильному котлу, тратит полдесятилетия на устранение его слабых мест и оказывается сидящим по правую руку от джаггернаута?

    Это путь, пройденный музыкальным руководителем Алексом Лакамуаром во время его сотрудничества с Лин-Мануэлем Мирандой: после получения Грэмми и Тони за работу над фильмом In the Heights Лакамуар был одним из первых людей в мире, кто испытал на себе чудо Гамильтон работает со своим другом, чтобы организовать и организовать шоу, а затем руководит производством записи его рекордного состава.Теперь он играет на клавишных и возглавляет ансамбль из десяти человек, что дает ему место в первом ряду на самый популярный билет на Бродвее. Разговаривая со Стервятником из его гримерки в Театре Ричарда Роджерса, Лакамуар сломал сложную архитектуру музыкальных тем Hamilton .

    Вы работали с Лином на Heights , когда у него возникла идея Hamilton . Какова была ваша реакция, когда он подошел к вам и сказал: «Привет, у меня есть мюзикл об отце-основателе?»
    У него в основном был лист с текстом песен, и он показал мне последовательность аккордов под рэпом.Обычно мы так поступали. Сначала это было интересно, потому что я просто не мог сказать, Это должно быть смешно? И он такой: «Нет, это чертовски серьезно». Как только я услышал это и понял, насколько это плотно, как он смог рассказать о 19 годах жизни в четырехминутной песне, я подумал: «Чувак, это дерьмо потрясающе!» Примерно через год после этого он сыграл мне «My Shot», и я начал понимать, насколько тяжелой и воодушевляющей была музыка. Что безумно было в том концерте, который мы дали в Белом доме, через несколько месяцев после того, как он сыграл мне эту песню.Это даже не был мюзикл. В то время это была просто идея для микстейпа.

    Обычной ночью вы играете на клавишных и отвечаете за группу. Что проносится в твоей голове?
    Знаете что смешного? Сколько раз я играл в шоу, я все равно его не запомнил. Он такой плотный. Но это удерживает меня в действии. Ситуация высока: часть клавиатуры технически не требовательна, но временами она очень хрупкая и очень открытая.Такая песня, как «Дорогая Феодосия» - одна оговорка, и я испортил момент. То же самое с "Это тихий квартал". Это последний настоящий разворот истории, ведущий к дуэли. Это последнее небольшое восхождение на гору.

    Как и многие фанаты Hamilton , я еще не видел шоу; Я только что записал запись актеров. Я знаю, что вы просили больше времени и денег, чем традиционное распознавание текста, чтобы вы могли его действительно усовершенствовать. На что были похожи эти разговоры?
    Atlantic оказала мне такую ​​поддержку, и я так благодарен за это.Я хотел проявить такую ​​осторожность, которую оправдывали эта запись и показ. Момент лампочки для меня означал осознание того, что каждому музыканту и актеру нужно платить, чтобы они были на записи, но неважно, соберете ли вы их всех в один день или распределите их на две недели, если вы придерживаетесь к правилам, которые заключаются в том, что вы должны пригласить актеров только на один день. Музыкантов можно распределить на полгода, не беда. Единственная разница - это количество времени в студии, за которое вы платите, а оно ничтожно мало.

    И тогда у вас есть Корни для производства.
    Когда мы собирали идеи продюсеров, которые мы выкопали, возникли The Roots, потому что они настолько эклектичны, что они так хорошо делают живые хип-хопы. Как только мы взяли их на борт, это было здорово. Они были очень полезны, потому что были очень объективны. Лин и я, мы настолько увлечены музыкой, что трудно увидеть это с высоты птичьего полета. Quest и Тарик сыграли важную роль в том, чтобы подтолкнуть нас к тому, чтобы пойти дальше с тем, что я называю «конфетой для ушей». Например: «Включите барабаны, потому что это и есть хип-хоп.Эти скребки для записей? Включите их. Тот момент голоса прямо здесь? Добавьте искажения. Барабаны? Сделайте так, чтобы это походило на ловушку ".

    Вы сейчас работаете над нотами. Чем это отличается от того, чтобы собрать все вместе для шоу?
    Подготовка нот к публикации - это попытка сделать их доступными для людей во всем мире, и я хочу, чтобы они максимально отражали то, как звучит песня. Когда Линь сочиняет песни, он поет их в свой компьютер и уходит прочувствовать.Медленно, но верно возникают небольшие несоответствия - актер вносит свой вклад в фразу, а Линь говорит: «Хорошо, сделай это так». Итак, я возвращаюсь и редактирую музыку, чтобы она отражала то, во что превратилось шоу. Есть фортепианные партии, которые использовались шесть лет; Моя работа - вернуться и спросить: «Эта книга по-прежнему точна?» Это процесс очистки.

    Какая песня доставляла вам больше всего хлопот за эти шесть лет работы?
    «Сестры Шайлер». У этого был большой макияж.Вне Бродвея это было чувство возврата, больше похожее на Daft Punk и Pharrell. Тогда [директор] Томми Кейл сказал: «Послушайте. Это единственная песня, которая на тебя не похожа ». Как будто мы пытались что-то имитировать. Между Бродвеем и Бродвеем мы спросили: «Как мы можем увеличить это число?»

    Затем мы поняли, что три сестры записали все эти Vines и видео, в которых они гармонируют в случайных песнях Destiny’s Child, и во многих обзорах говорилось: «Сестры Schuyler похожи на Destiny’s Child из шоу.«Мне не казалось, что музыка звучит достаточно, как Destiny’s Child, поэтому я вернулся и послушал« Bootylicious »и« Bills, Bills, Bills ». Я сделал аранжировку немного более современной. Затем я понял, что в песне нет ничего более крутого, чем гармония, которую делают девушки, когда они трахаются, поэтому мы добавили эти маленькие повороты, просто позволили им рифовать, извлекать выгоду из того факта, что у нас есть три крутых певца.

    Хорошо, теперь мы собираемся немного углубиться в сорняки. Я знаю, что "You’ll Be Back" полна отсылок к Beatles - Лин упомянул гитару "Getting Better" в финале.Какие еще?
    В атмосфере есть отсылка к «Пенни-лейн». В первом припеве вибрации идут [ напевает аккорды «Penny Lane» ]. Есть «Мистер. Кайт »отсылка:« Ты говоришь, что твоя любовь истощает, и ты не можешь продолжать », - звучит синтезатор: бах, данна-нах, данна-нах, данна-нах, . Басовая линия - сплошной паулизм. В «My sweet submissive subject» бас исполняет da-dunnoo-dunnoo , высокий триоль заполняет, а бас приглушен, так что он звучит как Hofner. Барабаны - a-ts-ts-ts-ts, ta-ts-ts - это заливка, которую я украл у Ринго.И то, как [Джонатан] Грофф напевает: «Всем!» в конце немного похож на Леннона из «Все, что тебе нужно, это любовь». Эта идея возникла в студии в последнюю минуту.

    А потом «Беспомощная» - это тотальная Бейонсе.
    Ссылка Бейонсе - «Стресс! Благослови! " звучит как «Хьюстонская ракета!» [в «Обратном отсчете»]. Мы просили девушек так доставить.

    Музыкальный театр Tumblr сходит с ума от бэк-вокала в «Александре Гамильтоне». Что там за история?
    Мы с Лином сделали эти гармонии вместе.Он сказал мне: «Я хочу, чтобы резервные копии пели:« Алекс, ты должен позаботиться о себе »». Я был тем, кто нашел, какие ноты они собирались делать, а затем мы с Лином вместе придумали «Standing» ! … Планирование! » Строка, которую я придумал, ooh-whoo-ooh-ohh , это фигура фортепьяно, которая переходит в «Пришел ураган и воцарились разрушения». Они отвечают на него: ох-ох-ох . Эта строчка взята из оригинальной демонстрации Лин.

    Раньше был дверной скрип; это был звуковой эффект, который пошел reeeeeeeee. Лин сказал: «Давайте расшифруем писк». Он стал тем пианино. Это были вступительные ноты, и я взял мяч и побежал с ним. В следующий раз аккорд будет той же формы, но на две ноты ниже. Затем он перемещается все ниже и ниже по шкале, так что он повторяется. И этот дверной скрип все еще присутствует в «Твоем послушном слуге», если вы прислушаетесь к самому началу.

    В конце концов, мы знали, что хотим, чтобы вся компания пела «Александр Гамильтон!» Когда они все поют в унисон, возникает разрыв, в котором ничего не происходит между «Александром Гамильтоном» и «ждущим своего часа».«Так что бэк-вокал был моей идеей, чтобы заполнить пространство. Я подумал: Что мы можем сделать тематическим?

    Мне нравится, когда Дэйвид Диггс и Окириете Онаодован гармонируют друг с другом. Они очень хорошо поют вместе, и этого нельзя было ожидать, потому что у Дэйвида такой уникальный голос. Как вы с этим справились?
    Вы пытаетесь угодить голосам парней. Например, в «Вашингтон на твоей стороне», когда Лесли, Дэвид и Оук гармонируют вместе, голос Лесли намного светлее; Голос Дэйвида намного более дерзкий, поэтому вы хотите, чтобы он был мелодией, так что это будет в центре внимания; а затем у вас есть Оук, у которого есть этот темный, насыщенный баритон.Когда они гармонируют на тему «Это должно быть хорошо, это должно быть ni -ice», у вас есть Дуб внизу, Дэвид в середине и Лесли, обеспечивающие обертоны. Если бы у них были разные регистры, это могла бы быть другая гармония.

    Какой атмосферы вы хотели добиться от битов в рэп-баттлах?
    Линь прекрасно понимала Джефферсона, который был в Париже. Это было так: вот тот, кто отстранен от того, что происходит в стране, и немного старше, поэтому он слушает более старую музыку.Вот почему его стиль рокабилли, Гил Скотт-Херон: старина по сравнению с хип-хопом, который делают другие парни. Это первое рэп-баттл, это скорее старая школа. Он даже произносит отсылку к Грандмастеру Флэшу: «а-ха-ха-ха-ха». В то время как во втором просто классная атмосфера Нептуна и Фаррелла. Бас очень круглый, в нем нет особой резкости, а барабаны супер Neptunes-y, типа boom-kat, boom-ta-tic-cacko!

    И как вы сделали так, чтобы «Брошюра Рейнольдса» звучала как стриптиз-клуб?
    Я не хотел этого, но если это то, что у вас есть, это совершенно круто. [ Смеется. ] На оригинальном демо Лина эта песня казалась такой жирной: в ней был крутой трэп, двойной хай-хет, зловещая басовая партия, она была на синтезаторе, Лин нашла эти bicka-ba -bicka-ba-bip звуков. Тот, что вышел из коробки, просто убил. Это была композиция, с которой не стоит связываться. Вы просто хотите узнать, как заставить группу сыграть ее и сделать так, чтобы она звучала хорошо.

    Я слышал, вы упомянули, что у каждого главного героя есть инструмент, который их представляет.
    Я использую виолончель для двух персонажей: Берра и Анжелики. Это показывает, насколько он универсален. Виолончель может быть действительно зловещей и зловещей, когда вы этого захотите, как в «Say No to This». В «Wait for It» виолончель дает намек на мелодию. Он соответствует голосу Лесли, он действительно шелковистый. У Анжелики также много моментов с виолончелью и арфой. Когда мы подходим к финалу, Элиза начинает говорить об Анжелике, я думаю, , хорошо, нам нужно что-то сделать, чтобы повторить ее тему , так что вы снова слышите эту строчку из «Доволен» на арфе.Речь идет о поиске способа вызвать ее, когда ее зовут по имени.

    Скрипка представляет Элизу. В «Этого было бы достаточно» есть высокая скрипка, которая перекликается с ее партией. То же самое и в финале: когда она говорит о приюте, звучит нежная скрипичная линия. Гамильтон такой кинетический, ударный и движущий, а Элиза - очень органичная, а не электрическая. Во многих ее моментах нет синтезаторных инструментов. «Этого было бы достаточно» - это полностью камерные акустические инструменты. То же самое и с «Burn», очень камерно.

    Инструмент Гамильтона - это барабаны?
    Думаю, да, будь то ударные синтезаторы или акустические барабаны. У Джорджа Вашингтона есть Wurlitzer. Это электрическое пианино. Рэй Чарльз часто этим пользовался. В нем чувствуется винтажность, ощущение старины, которое есть у Вашингтона - этот землистый, органичный рост. Это надежный инструмент, который так хорошо напоминает Криса Джексона.

    Давайте поговорим о двух шоу-стопах: «Подожди» и «Комната, где это происходит».
    «Wait for It» - мой любимый трек на пластинке.Мне нравится, что начало так сдержанно, а затем внезапно мост просто идет BWAAAH! , и в нем есть то эпическое ощущение. В этот момент Бёрр чувствует себя львом, прячущимся в кустах. Что мне нравится в записи, так это то, что мы рискнули с точки зрения панорамы. Особенно в конце, когда происходит много левого и правого - парни слева, девушки справа: «Подождите!» "Ждать его!" Он колеблется между вашими ушами, почти как голоса в голове Бэрра, каждый угол поет ему, какова его мантра.

    Лин знал, что он хотел, чтобы «Room Where It Happens» стала любовным письмом Кандеру и Эббу [дуэт авторов песен, стоящий за Cabaret и Chicago ]. Когда пришло время оркестровать это, дело дошло до того, что гитара может делать в песне? Я понял, Подожди секунду, гитара может играть на банджо! Либо это была самая крутая идея, либо самая неудачная идея. Я пригласил своего гитариста Робина, он позаимствовал банджо, сыграл на нем поверх моего демо, и меня зацепило - это звучало очень необычно, но также соответствовало стилю песни, которую мы вызывали.Это мой любимый выбор инструментов в шоу, потому что это не то, чего вы ожидаете.

    Заканчиваем выстрелом молнии. Я назову инструмент, а ты назовешь свой любимый образец в спектакле. Итак: струны?
    Наверное, «Это тихий квартал», когда больше ничего не играет, кроме этих двух парней. В лирике «Тихо на окраине» - вы не становитесь тише, чем две тихие струны.

    Фортепиано?
    «Этого было бы достаточно», в части: «Мне нравится быть твоей женой.«Он очень вдохновлен Адамом Геттелем, очень похож на Light на площади ». В «Ожоге» также есть часть, очень похожая на Геттеля: «Ты не имеешь права на мое сердце». Играть весело и сложно.

    Бэк-вокал?
    «Подожди», все это.

    Басовая линия?
    «Комната, где это происходит». Мне нравится, как он там себя чувствует, очень бугристый.

    Удар?
    Два из них. В «Десяти заповедях дуэли» я обожаю эти мизинцы: «Ваш лейтенант, когда есть счет ...» Дин! Динь! Мне также нравится это в «Брошюре Рейнольдса», этот двойной хай-хет на тему «Я знаю свою сестру, как я знаю свое собственное мнение.Перкуссия только начинается: Tickatickatickaticka-tsst-tsst . И это в прямом эфире.

    Ведущий вокал?
    Все, что поет Крис Джексон. Особенно «В последний раз», потому что Крис просто уходит. Каждую ночь все меняется; это то, что он чувствует. Это подарок для него - иметь возможность импровизировать так же красиво, как он это делает каждый раз. Это нокаут.

    25 величайших музыкальных реплик Эннио Морриконе

    Фото: Джим Дайсон / Redferns

    Эта статья изначально была опубликована в 2015 году.Мы переиздаем его в память об итальянском композиторе Эннио Морриконе, , скончавшемся 6 июля 2020 года в Риме.

    Квентин Тарантино « Ненавистная восьмерка» - это первый раз, когда легендарный композитор Эннио Морриконе записал целый фильм для режиссера, любящего спагетти-вестерна. (Действительно, это первый раз, когда какой-либо композитор из написал музыку для целого фильма для Тарантино, который обычно предпочитает, чтобы его музыка была изменена.) Морриконе, 86 лет, продолжал довольно стабильно работать, но это будет захватывающе для тех из нас, кто Любители композитора снова увидеть, как на него ярко светит свет софитов.Потому что сказать, что Морриконе - великий композитор саундтреков - или даже величайший из всех композиторов - не совсем справедливо. Его влияние огромно во всех музыкальных жанрах, а его нововведения были приняты даже музыкантами-авангардистами. На самом деле, многие люди, которые никогда не видели ни одного фильма, написанного на музыку плодовитого Морриконе, вероятно, все еще могут легко определить многие из его музыкальных тем. Не верите мне? Когда-нибудь насвистывайте несколько мелодий из The Good, the Bad and the Ugly или A Fistful of Dollars , и вы можете обнаружить, что даже люди, которые никогда не видели кадра из спагетти-вестерна, поймут, о чем вы говорите.

    В честь последнего релиза композитора показалось, что это подходящее время, чтобы продолжить его карьеру и выбрать некоторые из его лучших музыкальных реплик, то есть лучшие произведения, которые использовались в контексте отдельных сцен в фильмах. самих себя. (Не каждый режиссер всегда знал, как правильно использовать музыку Морриконе.) Конечно, это очень личный список - с учетом огромных размеров и разнообразия творчества этого человека, любой поклонник Морриконе обязательно найдет отдельные произведения, которые им больше нравятся, чем другие.Но вот они: 25 величайших музыкальных реплик Эннио Морриконе.

    В революционном фильме Бернардо Бертолуччи молодой человек из обеспеченной семьи борется со своими революционными идеалами и соблазнами буржуазной жизни. В одной из самых красивых сцен фильма помещик по имени Пак оплакивает потерю реки По и природную красоту вокруг него, вызывая гнев молодого героя, который признает в этом человеке многие противоречия своего сословия. Бертолуччи, как и Серджио Леоне, прекрасно понимал огромную силу Морриконе: его способность передавать противоречивые идеи через свою музыку, в отрывках, которые могли быть как романтическими, так и насмешливыми, лиричными и игривыми.

    Унылая атмосфера первого спагетти-вестерна Серджио Леоне - Эннио Морриконе - Клинта Иствуда отражает как бюджетные реалии, так и пустоту обстановки: напуганный, умирающий город, зажатый соперничающими кровавыми бандами, ожидающий, пока безымянный одиночка придет и спасет Это. И музыка Морриконе к фильму часто уместно минималистична, в ней используются свист Алессандро Алессандрони, гулкая электрогитара, треск хлыста и эти легендарные хоровые звуки («Мы можем сражаться!»).Это чертовски ужасно, быть маленьким ребенком и смотреть этот фильм по телевизору с цифрой , которая открывается.

    Хотя большая часть партитуры A Fistful of Dollars ’довольно скудна, для финального противостояния Морриконе дает нам что-то в целом более мелодичное и традиционное. Эта богато украшенная панихида также появлялась ранее в фильме, но здесь она идеально подходит для - когда облака динамитного дыма и пыли разлетаются, раскрывая характер Клинта Иствуда, который, казалось бы, воскрес из мертвых, чтобы отомстить Рамону Рохо и его банда.Это стало одним из фирменных произведений Морриконе, что несколько иронично, поскольку это также дань уважения партитуре Дмитрия Темкина для Джона Уэйна Вестерна Ховарда Хокса Rio Bravo .

    Музыкальные карманные часы - это повторяющийся элемент во втором фильме Серджио Леоне в трилогии «Человек без имени», и слышать, как Морриконе использует их в музыкальном плане, - одно из многих удовольствий фильма. Сами часы - это объект, который объединяет одного из хороших парней (которого играет Ли Ван Клиф) со злодеем, невменяемым бандитом Индио (которого играет Джан-Мария Волонте).Финальный поединок с его дуэльными часами прекрасно сочетается с нашим ожиданием; мы слышали мелодию часов раньше и думаем, что точно знаем, когда она закончится. Также обратите внимание, как мелодия слегка меняется каждый раз, когда она звучит в фильме, что отражает внутреннее состояние персонажей.

    Комическая аллегория Пьера Паоло Пазолини о политике и религии представляет собой один из самых странных и незабываемых эпизодов вступительных титров за всю историю. Кредиты поются в пародийно-героической и довольно запоминающейся мелодии - такой, которая настраивает зрителя в идеальное состояние, чтобы принять фильм, основанный на марксистской теории, туалетном юморе, кадрах с настоящих политических похорон, интермедии о Св.Фрэнсис и говорящая коммунистическая ворона.

    Шедевр Джилло Понтекорво - один из самых устойчивых фильмов , когда-либо созданных. Это документальный портрет алжирского конфликта, который на протяжении многих лет воспринимался колонизаторами, борцами за свободу, полицией, оккупационными армиями и террористами (не говоря уже о киноманах). Часть непреходящей привлекательности фильма должна быть новаторская, тревожная музыка Морриконе. Нигде его подход не проявляется более явно, чем в самом конце, где мы наблюдаем хаотический протест под аккомпанемент грохочущих воинственных барабанов, которые мы слышали на протяжении всего фильма, часто во время бомбардировок, и волн пронзительных электронных завываний.Затем, вкратце, мы слышим две прекрасные фразы упорядоченной, грустной темы клавесина, за которыми сразу же, как только мы угасаем, следует небольшой зазубренный повторяющийся мотив в минорной тональности. Нестабильный и вопрошающий, он посылает нас на неуверенную и тревожную ноту.

    Партитура Морриконе по вестерну с участием Берта Рейнольдса в главной роли, поставленного Серджио Корбуччи, - одна из его самых переделанных. (Даже Александр Пейн использовал его в Election .) Вполне понятно: с его смелым сочетанием воплей, раскачивающегося фортепиано и воющих барабанов он действительно первобытный - по крайней мере, до тех пор, пока не сработают гитара, хор и оркестр, и в этот момент он становится прямо-таки мифическим.Самый распространенный мотив партитуры повторяется повсюду: мы впервые слышим его в самом начале, когда видим жену Джо, убитую и скальпированную злодеями, так что когда он возвращается, прямо здесь, в конце, мы чувствуем часть собственной кровожадности Джо. и месть.

    Вот тот, чей клип мне не удалось найти на YouTube, хотя, по крайней мере, сам фрагмент есть. Партитура Морриконе для вестерна Серджио Соллимы, в которой Ли Ван Клиф играет стойкого законника, а Томас Милиан играет бандита Кучилло, метающего ножи, которого он сначала преследует, а затем объединяет силы, заслуженно известен, поскольку это один из самых трогательных и трогательных произведений композитора. взрывные работы.Из этого саундтрека есть несколько примечательных произведений, но этот, который играет во время погони в третьем акте, является одной из лучших реплик Морриконе.

    Одно из самых известных произведений Морриконе - Metallica использовала его для своих концертных вступлений - этот продолжительный, незабываемый, драйвовый оркестровый и хоровой фрикцион является прекрасным примером сотрудничества Леоне и Морриконе. Кто еще, кроме этих двоих, мог бы уделять столько экранного времени только кадрам Эли Уоллаха, бегущего по кладбищу, доведенным до абстракции? В этот момент Леоне знает, что музыка - настоящая звезда, и позволяет Морриконе одержать верх.

    Хотя его иногда отодвигает на задний план «Экстаз золота» - саундтрек по кладбищу, который ему предшествует, в финальном поединке « Хороший, плохой и злой» также представлены некоторые из лучших и самых сложных работ Морриконе. Слушайте это полностью, пока прекрасные соло трубы и щелкающие кастаньеты уступают место чему-то более экспериментальному, атональному и синтезированному. Это должны быть футуристические выстрелы, возможно, в ожидании грядущей стрельбы? И предназначены ли эти другие звуки, чтобы они походили на капли воды космической эры, подчеркивая пот на лицах актеров? (Неужели я слишком много об этом думаю? Да!) Это как если бы партитура была деконструирована на полпути - вместе с изображениями, по мере приближения камеры к актерам и редактирование становится более фрагментарным - прежде чем вернуться к громоподобному, катящемуся крещендо.А потом, после всего этого … эта чертова штука обрывается до того, как музыка заканчивает , когда Клинт Иствуд стреляет в Ли Ван Клифа, а Эли Уоллах обнаруживает, что в его пистолете нет пуль.

    Безумная пародия Марио Бавы на выходки в стиле Джеймса Бонда - один из самых странных фильмов, которые я когда-либо видел, а музыка Морриконе к нему - прекрасная капсула времени измов 60-х. Эта сцена, действие которой происходит в пропитанном наркотиками ночном клубе, наполненном фанком faux , нечетким искажением, бубнами и пением, идущим под откос всех молодых людей, дает вам хорошее представление о том, как выглядит остальная часть фильма.Работа Морриконе здесь прекрасна, хотя и в некотором роде: она похожа на поп-песню, сочиненную кем-то, кто читал только описания поп-песен.

    После трилогии «Человек без имени» Леоне и Морриконе вместе работали над одним из самых амбициозных вестернов в истории. На этот раз Морриконе заранее сочинил партитуру, чтобы Леоне включал записи своей музыки на съемочной площадке, чтобы привлечь актеров на сцену и отследить движения камеры. Эта возвышенная сцена показывает плоды такого подхода.В нем Джилл из Клаудии Кардинале стоит одна на вокзале и ждет, когда ее встретят. Когда она начинает понимать, что никто не идет, мы слышим в саундтреке меланхоличную сольную певицу. Затем Джилл входит в здание вокзала, музыка начинает нарастать, и камера поднимается вверх и над крышей… так что мы видим с другой стороны шумное, почти сказочное видение американского Запада. И , затем , окружающий звук людей, повозок и лошадей, который, как ни странно, отсутствовал до сих пор, внезапно входит в саундтрек.

    Звук стремительных шагов, отслеживающий выстрел POV, переход к этому внезапному крупному плану, приуроченный к этому внезапному, искаженному, перекликающемуся аккорду. (Может ли , что быть единственной величайшей репликой из музыки к фильму?) Мы наблюдаем, как этот ребенок (которого мы никогда не встречали и никогда не будем) оглядывается и понимает, что вся его семья была застрелена. А затем эти мрачные пыльные фигуры появляются из кустов, когда воющий ветер сливается с воем. Они выглядят так, как будто они из другого мира - что так и есть, поскольку этот момент идеально отражает классическую западную тему цивилизации против жестокости.И затем последний, идеальный удар: тележки камеры движутся вокруг фигуры, ведущей мужчин, чтобы раскрыть, что Генри Фонда - Генри Фонда! Образец порядочности и морального авторитета американского кино! - это чудовище в центре этой бойни.

    В основополагающем триллере Дарио Ардженто «Джалло» 1970 года колыбельная тема Морриконе сопровождает чрезвычайно жуткое преследование первой жертвы фильма в таком противопоставлении, которое фильмы ужасов доили в течение многих лет. Это вступительные отрывки одной из самых ярких композиций Морриконе, но сама пьеса не длится до самого конца, что делает фильм красивым.За свою карьеру Морриконе написал множество джалло-триллеров, и хотя его музыкальные произведения к этим фильмам не так хорошо известны, как некоторые из его спагетти-вестернов, они часто довольно тревожные и сами по себе авангардные.

    В дикой западной Сапате Серджио Корбуччи мятежный крестьянин Томас Милиан и шведский наемник Франко Неро должны объединить свои силы во время мексиканской революции. Это один из тех спагетти-вестернов, где персонажи из совершенно разных слоев общества вынуждены объединяться войной и революцией, и какофоническая, хаотичная и шумная музыка Морриконе отражает это.В частности, главная тема фильма «Vamos a matar, compañeros» («Пойдем и убьем, товарищи») играет здесь, в конце, когда сдержанный, методичный одиночка Нерона выпускает последний рев, решая присоединиться к битве с его товарищи.

    Нежный, захватывающий рассказ Джулиано Монтальдо о двух итальянских иммигрантах и ​​анархистах, арестованных и казненных за убийство в Массачусетсе в 1927 году, включает пару самых известных песен Морриконе: «Вот тебе» и «Баллада о Сакко и Ванцетти». оба в исполнении Джоан Баэз.Но в нем также присутствует эта лирическая интермедия ближе к концу фильма, когда Ванцетти пытается убедить Сакко взглянуть через решетку тюремной машины, в которой их перевозили с суда, где они только что были приговорены к смертной казни. Удивительно, но саундтрек к фильму довольно скудный, и Морриконе большую часть времени молчит, что только усиливает силу таких моментов.

    Конечно, ни один список Морриконе не был бы полным без этого сотрудничества с Джоан Баэз. Но посмотрите, насколько хорошо он устроен и использован: когда упрямый Ванцетти бодро садится на электрический стул, включается похоронный орган, а затем, как только его констатируют мертвым (на полностью черном экране), внезапно раздается эта воодушевляющая народная песня. в, как если бы персонаж фактически перешел в миф.Это отличный способ закончить один из самых удручающих фильмов в истории.

    Большинство зрителей, вероятно, знакомы с этой темой по ее повторному использованию в фильме Квентина Тарантино « Бесславные ублюдки» , но стоит поискать фильм братьев Тавиани, из которого она родом, так как это почти шедевр. Allonsànfan - это трезвый, но стилизованный взгляд на революционера 19 века (Марчелло Мастроянни) из богатой семьи, который разрывается между своими идеалами, бывшими товарищами, любовью к сыну и удобствами счастливой и тихой жизни.Как и во многих фильмах Тавиани, в нем сочетаются сказочная простота с отрывками сюрреалистической красоты - особенно в этой сцене ближе к концу, где жизнерадостная ритмичная музыка уступает место странно зловещему, топающему ногами танцу.

    Для безумно амбициозного, звездного пасторального марксистского эпоса Бернардо Бертолуччи Морриконе сочинил одну из своих самых прекрасных и резонансных мелодий. Бертолуччи открывает свой фильм сценами из Дня освобождения Италии в 1945 году, показывая восстание крестьян против помещиков.Но затем он вспоминает и рассказывает историю, охватывающую многие десятилетия, изображая истоки классового сознания, социализма и фашизма в регионе Эмилия-Романья. К тому времени, когда мы вернемся к этим сценам ближе к концу фильма, эти крестьяне приобрели благородную ауру, визуально и звуковую. Но музыка также должна играть здесь тонкую роль, потому что то, что изображает Бертолуччи, не то, что на самом деле произошло в 1945 году; это его идеализированная версия. Это исторический фильм, который превращается в фантастику, и музыка Морриконе блестяще это отражает.

    Морриконе и Терренс Малик, как известно, не ладили в этом фильме - композитор думал, что загадочный режиссер вообще не понимает музыку из кинофильма. Но каким-то образом их сотрудничество сработало. Эта партитура вполне может быть одним из величайших и самых романтичных произведений Морриконе. (Даже если он должен разделить часть заслуг с Камиллой Сен-Санс, чей «Карнавал животных» также так эффективно используется Маликом.) Но, возможно, его кульминацией является кульминационная чума саранчи, которая спускается ближе к концу фильма. , превратив эту ферму в Эдемском Техасе в огненный ад ревности и возмездия.Диссонирующая музыка Морриконе с ее резкими, диссонирующими струнами и дребезжащими фортепиано работает в тандеме со звуковыми эффектами и обрывками кричащих диалогов, создавая эффект, который кажется нереальным и неконтролируемым.

    «Лапша , я поскользнулся ». Грандиозный финальный фильм Леоне сейчас считается шедевром, но он не был так хорошо принят, когда впервые вышел, отчасти потому, что в 1980-х зрители не знали, что делать с его смесью мрачного гангстерского эпоса и моментов насыщенная мелодрама.Возьмем эту раннюю сцену, душераздирающий, откровенно эмоциональный момент, когда наши герои, группа бруклинских хулиганов, выросших в 1920-х и 30-х годах, теряют одного из своих. Смотрите и слушайте, как одинокая пан-флейта (на которой играет великий Георгий Замфир) сочетается с одиноким мальчиком, оставленным на открытом воздухе, неспособным спрятаться, пока его друзья укрываются. Это манипулятивно? Конечно. Но даже если вы попытаетесь противостоять этому, это такая сцена, которая умело вырвет из вас слезы.

    Эпопея Ролана Иоффе 1986 года, повествующая о борьбе небольшой группы иезуитов в общине гуарани против испанских и португальских колонистов, по-своему связана не только с религией или историей, но и с музыкой: отец Джереми Айронса Габриэль и туземцы изначально соединяются через гобой, и религиозная музыка играет ключевую роль во всем.Но, возможно, самая яркая реплика фильма - это самая яркая сцена. Раскаявшийся работорговец и солдат, которого играет Роберт Де Ниро, тащит свои доспехи и оружие в гору в качестве средства покаяния. Индейцы знают его, и поначалу они напуганы и подозрительны. Но затем один человек подходит к Де Ниро и срезает его тяжелую ношу. Это момент напряженной, подавляющей человечности, прекрасно подчеркнутый мелодичной музыкой Морриконе.

    Для хита Брайана Де Пальмы 1987 года, в котором команда доброхотов Кевина Костнера пыталась одолеть Аль Капоне Роберта Де Ниро, Морриконе создал резкую, напряженную партитуру, которая временами использовалась озорно.Здесь, в одном из первых успехов команды «Неприкасаемые», когда они совершают набег на операцию по контрабанде спиртных напитков на канадской границе, фильм на короткое время начинает напоминать вестерн. Музыка возбуждает, но в некотором роде также подрывает действие; В широте проявленного героизма есть нечто сюрреалистическое, как будто мы втайне знаем, что он не может длиться долго.

    В конце любимого оскароносного фильма Джузеппе Торнаторе взрослый Сальваторе, который когда-то был помощником киномеханика в кинотеатре своего городка, садится смотреть таинственную киноленту, подаренную ему ныне покойным киномехаником постарше. .Оказывается, кадры - это монтаж всех сцен поцелуев, которые киномеханик был вынужден снимать на протяжении многих лет под бдительным присмотром местного священника. Музыка Морриконе здесь, одна из самых известных, наполнена одновременно удивлением и сожалением.

    Морриконе воссоединился с Иствудом для этого великого триллера Вольфганга Петерсена о стареющем агенте секретной службы, пытающемся выследить убийцу (Джон Малкович), угрожающего убить президента Соединенных Штатов. Это отличный триллер, но он также на удивление мрачный и задумчивый.Здесь, в один из тихих моментов фильма, персонаж Иствуда вспоминает своему коллеге-агенту Рене Руссо тот день в ноябре 1963 года, когда ему не удалось спасти жизнь Джона Ф. Кеннеди. Это одно из самых ярких выступлений актера. Но это даже больше, чем это: когда его персонаж оглядывается назад, на напряжение напряженной, меланхоличной партитуры Морриконе, Иствуд теряет всякое притворство, и мы внезапно чувствуем, что наблюдаем за самим человеком, оглядываясь назад на его собственную жизнь ... и даже он, кажется удивленным тем, что вот-вот заплачет.

    (PDF) Влияние стервятников на факультативных падальщиков и потенциальные последствия для передачи болезней млекопитающих

    Ogada et al. 7

    0

    5

    10

    15

    20

    25

    поросят

    гиены

    полосатые

    гиены

    шакалы

    0005

    Рис. 2. Влияние отсутствия стервятника на численность падальщиков

    млекопитающих на экспериментальных тушах

    (n = 14 пар).Опытные туши были парными.

    Одна туша была размещена на открытом воздухе, чтобы побудить

    стервятников к падению, а вторая была помещена под

    деревьев, чтобы отпугнуть стервятников (∗ p <0,05, ∗∗ p <0,01, ∗∗∗ p <

    0,001).

    подростков, которые регулярно контактируют

    друг с другом (например, члены одного клана). Таким образом,

    контактов, которые мы наблюдали, могут не отражать значительного увеличения общего числа контактов

    , имевших место у какого-либо одного человека.Частота контактов внутри кланов спот-

    тед гиен определяется социальным статусом. Например,

    , взрослые самки имеют наибольшее количество оральных контактов (

    ) (облизывание с открытым ртом) с членами клана (Восток

    ,

    и др., 2001). Однако также возможно, что контакты

    между людьми из разных кланов происходят часто

    у туш, увеличивая вероятность как первичной передачи

    в туше, так и вторичной передачи

    другим членам группы, когда люди возвращаются в свои

    соответствующие логова.Мы полагаем, что передача

    болезней плотоядных напрямую через туши может увеличиться на

    по мере сокращения численности стервятников или их искоренения. Хотя мы наблюдали

    на млекопитающих, изменения в численности птичьих стервятников

    (желто-коричневых орлов) были наиболее выраженными при отсутствии стервятников

    . Обильные птичьи падальщики, такие как

    вороны, могут передавать болезни через туши, так как численность стервятников

    снижается. Например, в Бангладеш, регион

    со значительным снижением численности стервятников, погибло

    ворон дали положительный результат на высокопатогенный вирус гриппа

    (H5) (Giasuddin et al.2009 г.). Однако

    когда-либо, по сравнению с африканскими млекопитающими, очень мало работ

    было сосредоточено на болезнях птичьих падальщиков, в том числе

    грифов.

    По мере того, как численность стервятников сокращается или стервятники исчезают -

    , количество добровольных падальщиков млекопитающих

    , вероятно, увеличится, что может привести к тому, что

    туши станут центрами передачи болезней для

    падальщиков млекопитающих. Передача хищников

    облегчается через домашних собак, которые кормятся на тушах

    боковых гиен и шакалов в районах, где отсутствуют стервятники

    (Butler & du Toit 2002), хорошо задокументировано (Alexander

    & Appel 1994 ; Кливленд и др.2000; Lembo et al. 2008 г.).

    Однако степень распространения патогенных организмов

    на тушах неизвестна.

    Благодарности

    Это исследование финансировалось за счет грантов Смитсо-

    нянского института, Фонда Перегрина, Raptor Research

    Foundation - Премия Лесли Брауна, Честерского зоопарка и

    Смитсоновского института тропических исследований. Стипендия Smithso-

    nian Mpala оказывала материально-техническую поддержку Д.O.

    Мы благодарим R. Eraguay за помощь на местах. Исследовательский центр Mpala

    обеспечил материально-техническую поддержку, и, в частности, мы

    благодарим М. Литтлвуда и Дж. Накалоньо за их помощь. Мы благодарны за поддержку и советы

    , предоставленные С. Томсеттом, Л. Франком, Р. Вудроффом и М.

    Вирани. К. Кройдер Джонсон, Э. Флейшман, К. Бильдштейн,

    и П. Дашак предоставили ценные комментарии, которые существенно улучшили рукопись.

    Цитированная литература

    Александр, К. А., и М. Дж. Г. Аппель. 1994. Африканские дикие собаки (Lycaon

    pictus), находящиеся под угрозой исчезновения из-за эпизоотии собачьей чумы среди куполов -

    тиковых собак возле национального заповедника Масаи Мара, Кения. Журнал

    Болезни дикой природы 30: 481–485.

    Александр К.А., П.В. Кат, Р.К. Уэйн и Т.К. Фуллер.

    1994. Серологическое исследование избранных собачьих патогенов среди

    шакалов, находящихся на свободном выгуле, в Кении. Журнал болезней дикой природы 30:

    486–491.

    Bl´

    azquez, M., J. A. S´

    anchez-Zapata, F. Botella, M. Carrete, and S. Egu´

    ıa.

    2009. Пространственно-временная сегрегация факультативных падальщиков птиц на

    тушах копытных. Acta Oecologica 35: 645–650.

    Батлер, Дж. Р. А. и Дж. Т. дю Туа. 2002. Рацион домашних

    собак (Canis familis) в сельской местности Зимбабве: последствия для диких

    падальщиков на периферии заповедников.Охрана животных-

    ция 5: 29–37.

    Батлер, Дж. Р. А., Дж. Т. дю Туа и Дж. Бингхэм. 2004. Домашние животные, находящиеся на свободном выгуле,

    ,

    собаки (Canis knownis) как хищники и жертвы в сельских районах Зимбабве:

    угрозы конкуренции и болезней крупным диким хищникам. Biologi-

    cal Conservation 115: 369–378.

    Кливленд, С., М. Дж. Г. Аппель, В. С. К. Чалмерс, К. Чиллингворт, М.

    ,

    Кааре и К. Дай. 2000. Серологические и демографические данные о

    домашних собаках как источнике заражения вирусом чумы собак для

    диких животных Серенгети.Ветеринарная микробиология 72: 217–227.

    Крафт, М. Э., П. Л. Хоторн, К. Пакер и А. П. Добсон. 2008. Dy-

    Намика мультихозного патогена в сообществе хищников. Журнал

    Экологии животных 77: 1257–1264.

    DeVault, T. L., O. E. Rhodes и J. A. Shivik. 2003. Поедание

    позвоночных: поведенческие, экологические и эволюционные перспективы

    на важном пути передачи энергии в наземных экосистемах.

    Ойкос 102: 225–234.

    ДеВо, Т. Л., И. Л. Брисбин и О. Э. Родос. 2004. Факторы, влияющие -

    на приобретение падали грызунов падальщиками позвоночных и

    разлагателями. Канадский зоологический журнал 82: 502–509.

    East, M. L., H. Hofer, J. H. Cox, U. Wulle, H. Wiik и C. Pitra. 2001.

    Регулярное заражение вирусом бешенства и отсутствие симптомов заболевания в

    Пятнистых гиенах в Серенгети. Труды Национальной академии наук

    98: 15026–15031.

    Giasuddin M., et al. 2009 г. Вспышка и частота циркулирующих штаммов

    вируса птичьего гриппа в Бангладеш в 2007–2008 гг. Страницы

    Биология сохранения

    Том 00, № 0, 2012

    New Amsterdam Records - Альбомы

    « Vulture Prince - это повторное посещение мест, которые я назвал своими, - говорит Афтаб, - мест, которые не обязательно существуют больше. Речь идет о людях, дружбе, отношениях - некоторых отношениях, которые были неожиданно кратковременными, и о том, как с этим бороться.

    Во время написания Принц стервятников Афтаб потеряла своего младшего брата, Махера, и она посвящает этот альбом его памяти - сигнал выхода из утраты и горя. «E quindi uscimmo a revider la stelle, - как наконец говорит Данте из ада, - и оттуда мы вышли, чтобы снова увидеть звезды».

    Играя вторую главу в дебютном альбоме Афтаб в 2015 году, Bird Under Water, Vulture Prince открывает новую композицию «Baghon Main», трек из ее первого альбома.Заголовок песни, наряду с названиями птичьего альбома, служит связующим звеном между двумя пластинками. «На ум приходит Башня Безмолвия, - говорит Афтаб, - похоронное сооружение парсов, где их любимые умершие оставлены на произвол судьбы для стервятников, таким образом возвращаясь к круговороту жизни. Такого рода элементы, меняющие форму, горячее желание воплотить и возглавить эту мистическую наследственную силу, рост как личности и музыканта - все это привело к Vulture Prince.

    Конечно, авторский стиль Афтаба привел к созданию Vulture Prince. Композитор обладает сверхъестественной способностью сочинять музыку со слоями инструментовки, но каким-то образом все это кажется очень легким, лаконичным, минималистичным для ушей. Музыка Афтаб затем отражает ее голос, неземной, но тяжелый - как облако, пересеченное валуном.

    Выпускник музыкального колледжа Беркли, композитор направляет артистов от Терри Райли до Абиды Парвин, выступал на различных площадках от Линкольн-центра до (Ле) Пуассон-Руж и Музея современного искусства. В 2020 году Афтаб сочинил музыку для фильма Bittu , номинированного на премию Американской киноакадемии, и спел на сингле Antes Que El Mundo Se Acabe, получившем премию Latin Grammy от Residente.На Vulture Prince, ее поддерживает звездный состав, в том числе Бади Асад, Мейв Гилкрист, Джейми Хаддад, Кенджи Герберт, Шажад Исмаили, Джульетта Джонс, Петрос Клампанис, Надже Нордхейс, Гайан Райли и Дариан Томас.

    Итак, это Vulture Prince - красивый, мощный, смуглый и, прежде всего, продуманный. В новый альбом вошли синглы «Mohabbat» и «Last Night», старое стихотворение Руми, которое Афтаб часто поет вживую, но никогда раньше не издавалось. В « Vulture Prince » тонко вписана песня «Saans Lo», слова которой написала покойная подруга композитора Энни Али Хан, которая мягко советует нам дышать - двигаться дальше.Через семь минут «Saans Lo» превращается в размытый гул, а затем открывается красочный джазовый «Suroor» - динамичный новый мир возможностей.

    Молекулярная характеристика переносчиков органических анионов 1 и 2 Gyps africanus (африканский белоспинный стервятник), экспрессируемых в почках

    Abstract

    Ранее было показано, что виды Gyps очень чувствительны к токсическим эффектам диклофенака, когда они присутствуют в их пищевых источниках в виде остатков лекарств после использования в ветеринарии.Стервятники, подвергшиеся воздействию диклофенака, вскоре впадают в депрессию и умирают с признаками тяжелой висцеральной подагры и повреждения почек при вскрытии. Молекулярный механизм токсичности и почечной экскреции мочевой кислоты все еще плохо изучен. С клиническими картинами, предполагающими выделение мочевой кислоты почками в качестве целевого участка токсичности, в качестве первого шага было предпринято следующее исследование для определения путей выделения мочевой кислоты, присутствующих у африканского белоспинного грифа ( Gyps africanus ) (AWB), один из видов, подверженных токсичности.Используя анализ транскриптома, иммуногистохимию и функциональные прогнозы, мы продемонстрировали, что AWB использует транспортер органического аниона 2 ( OAT2 ) для выделения мочевой кислоты. Анализ RT-qPCR впоследствии продемонстрировал относительно сходную экспрессию транспортера OAT2 у грифов и цыплят. Наконец, док-анализ предсказал, что нестероидные препараты вызывают свою токсичность за счет аллостерического связывания.

    Образец цитирования: Nethathe B, Phaswane R, Abera A, Naidoo V (2021) Молекулярная характеристика транспортера 1 и 2 органических анионов Gyps africanus (африканский белоспинный стервятник), экспрессируемого в почках.PLoS ONE 16 (5): e0250408. https://doi.org/10.1371/journal.pone.0250408

    Редактор: Адам Кейн, Университетский колледж Дублина, ИРЛАНДИЯ

    Поступило: 17 ноября 2020 г .; Одобрена: 6 апреля 2021 г .; Опубликован: 4 мая 2021 г.

    Авторские права: © 2021 Nethathe et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Данные доступны на NCBI для необработанных чтений (PRJNA560189) и гена OAT2 (MK879652). Дополнительные файлы генов доступны в NCBI по номерам MK854995, MN6 и MN6.

    Финансирование: Исследование было поддержано Национальным исследовательским фондом, номер гранта CPRR130589. Арон Абера работает в Inqaba Biotechnology. Финансирование не имело никакого значения для дизайна исследования, сбора и анализа данных, решения о публикации или подготовки рукописи, а только обеспечивало финансовую поддержку в виде заработной платы автора и материалов исследования.Спонсор предоставил поддержку в виде заработной платы автору [A.A], но не имел никакой дополнительной роли в дизайне исследования, сборе и анализе данных, решении опубликовать или подготовке рукописи. Поздний автор помог с секвенированием по Сэнгеру.

    Конкурирующие интересы: Арон Абера работает в Inqaba Biotechnology. Это не влияет на нашу приверженность политике PLOS ONE в отношении обмена данными и материалами.

    1. Введение

    Связанная с диклофенаком токсичность и массовая гибель были хорошо задокументированы для трех видов Gyps на азиатском континенте после заражения их источника пищи в результате ветеринарного использования препарата у крупного рогатого скота [1].Несмотря на то, что птицы умирают уже через 48 часов после заражения с беспрецедентной смертностью популяции, превышающей 99%, и миллионы птиц были найдены мертвыми, механизм токсичности остается плохо изученным [2]. Текущие предположения заключаются в том, что токсичность связана с функцией почек в результате патологического обнаружения висцеральной подагры у недавно погибших птиц. Подагра - это патологическое проявление, которое возникает в результате осаждения солей уратов в брюшной полости после достижения точки насыщения плазмы.В качестве вещества мочевая кислота вырабатывается печенью при расщеплении пуринов, как эндогенных, так и экзогенных, и сохраняется в плазме в виде тщательно контролируемой суспензии [3]. Для дальнейшего поддержания последнего гомеостаза почки играют ключевую роль в выведении мочевой кислоты, которая проявляется в виде белого остатка в птичьих экскрементах. Несмотря на важность почечной системы в экскреции мочевой кислоты, путь выделения мочевой кислоты у грифов еще не описан. Тем не менее, было высказано предположение, что угнетение функции почек, вероятно, объясняет развитие подагры.

    Из исследований на людях (продуценты низкой мочевой кислоты) известно, что почки способствуют поддержанию гомеостаза, удаляя мочевую кислоту за счет комбинации клубочковой фильтрации и секреции проксимальных извитых канальцев (ПКТ) [4]. В первом случае процесс облегчается перепадом давления в клубочках в зависимости от размера, в то время как последний опосредуется активным транспортным механизмом. Из этих двух ПКТ является более сложным физиологическим процессом, поскольку клетки здесь являются основным физиологическим барьером для пассивной диффузии заряженных гидрофильных молекул из крови в канальцы.Чтобы преодолеть это, клетки используют десятки мембраносвязанных белков-переносчиков; транспортные белки-переносчики растворенных веществ (SLC), идентифицированные как OAT1 от до OAT4 (от SLC22A6 от до SLC22A8 для OAT1 от до OAT3 и SLC22A11 для OAT4 ) [5-8]; белок множественной лекарственной устойчивости ( MRP2 / ABCC2 и MRP4 / ABCC4 ) и транспортер уратов 1 ( URAT1 ) [9, 10].Транспортеры OAT1 и OAT3 локализованы в базолатеральной мембране клеток проксимальных канальцев почек и опосредуют перемещение органических анионов, таких как мочевая кислота, из плазмы в клетки PCT посредством обмена дикарбоксилат / органический анион. В то же время ко-транспортер натрийзависимого дикарбоксилата (NADC-3) способствует переносу выведенного из организма дикарбоксилата обратно в клетки. Изнутри клеточной цитоплазмы мочевая кислота секретируется транспортерами MRP2 и MRP4 , расположенными на апикальной клеточной мембране почечных канальцев, в почечные канальцы.Процесс транспортера ОАТ и MRP известен как канальцевая секреция. В то же время мочевая кислота, присутствующая в канальцах, либо от клубочковой фильтрации, либо от канальцевой секреции, может реабсорбироваться обратно в системный кровоток через дикарбоксилатные или гидроксильные ионы и обмен монокарбоксилата с помощью OAT4 и URAT1 соответственно, которые также локализованы. в апикальной мембране в процессе, известном как тубулярная реабсорбция [7, 11, 12].

    Неудивительно, что при таком сложном механизме гомеостаз мочевой кислоты основан на тонком балансе между клубочковой фильтрацией, канальцевой секрецией и канальцевой реабсорбцией.Этот тонкий баланс зависит от воздействия любого вещества, влияющего на образование мочевой кислоты, или веществ, препятствующих выведению. Для первых диета с высоким содержанием белка может привести к увеличению образования мочевой кислоты, в то время как лекарственные вещества могут ингибировать функциональность транспортных белков. Помимо естественных анионных веществ, ОАТ также участвуют в выведении ряда лекарственных средств, таких как нестероидные противовоспалительные препараты (НПВП), противовирусные препараты и β-лактамные антибиотики [13].При взаимодействии лекарств с переносчиками, исследования также показали, что пробенецид и другие урикозурические препараты, такие как НПВП, в процессе выделения также ингибируют опосредованный ОАТ транспорт многих органических анионов [14], что делает их полезными для лечения подагры у людей. .

    Хотя механизм экскреции у стервятника неизвестен, из ограниченной информации у цыплят, выведение мочевой кислоты происходит по тому же механизму, что и у людей, с некоторыми ключевыми отличиями [15].В отличие от млекопитающих, которые в основном используют мочевину в качестве азотсодержащего экскреторного продукта, птицы используют для выведения преимущественно мочевую кислоту, т.е. птицы обладают урикотелином и производят значительно более высокие концентрации мочевой кислоты [15–17]. В результате экскреторные потребности в мочевой кислоте у птиц намного превышают способность клубочковой фильтрации, в результате чего канальцы отвечают за выведение до 80% мочевой кислоты [18]. Чтобы еще больше усилить выведение мочевой кислоты, птицы не реабсорбируют мочевую кислоту, и до сих пор не было описано транспортеров URAT1 .Из исследований [15] с использованием праймеров, полученных из транспортной последовательности OAT человека, было описано, что основной путь выделения мочевой кислоты курицы опосредуется транспортерами OAT1 и OAT3 . В связи с отсутствием информации о стервятниках старого мира, в данном исследовании мы пытаемся охарактеризовать белки-переносчики мочевой кислоты как первый шаг в установлении механизма токсичности диклофенака у стервятников. Мы также используем курицу в качестве вида сравнения, так как это единственный вид, не являющийся грифом, продемонстрировал чувствительность к токсическим эффектам диклофенака в лабораторных условиях, хотя и в 10-кратной дозе 10 мг / кг [2].

    2. Материалы и методы

    2.1. Идентификация транспортеров, присутствующих в стервятнике

    2.1.1. Исследования OAT по почкам грифов AWB и домашних кур с использованием опубликованных праймеров.

    Перед началом экспериментов этическое разрешение для сбора образцов было проведено в соответствии с руководящими принципами и правилами, утвержденными Комитетом по этике животных Университета Претории (AEC) (номер проекта: V108-16). Транспортеры мочевой кислоты оценивали у двух взрослых AWB ( Gyps africanus ), которые были подвергнуты эвтаназии по медицинским причинам.Для контроля при необходимости использовали почечную ткань курицы или мыши. Для AWBV1 и курицы общую РНК экстрагировали из образцов почек с использованием набора RNeasy plus mini (Qiagen) в соответствии с инструкциями производителя и хранили при -80 ° C для обратной транскрипции. Обратную транскрипцию проводили с использованием набора ClontechSmart MMLV Reverse Transciptase согласно инструкции производителя. OAT3 Праймеры для цыплят (прямой 5`CCCTTCTTCCTCTTCTTCCTCG-3` и обратный 5`-TGGATCAGATAAATGCTGACCCC-3`), описанные в [15], использовали для частичной амплификации (праймер, поставляемый Integrated DNA Technologies, Южная Африка).Реакции ПЦР были подготовлены с использованием набора Fermentors в соответствии с инструкциями производителя. Условия амплификации были следующими: 38 циклов с денатурирующей температурой 94 ° C, температурой отжига 61,6 ° C и температурой удлинения 72 ° C [15]. Ампликоны секвенировали на генетическом анализаторе ABI 3500X1 (Inqaba Biotechnology, ЮАР). Сравнения выравнивания проводили с последовательностью (BBSRC Chick EST ID 603812145F1), описанной в [15]. Полученная последовательность также была дополнительно проанализирована с использованием алгоритма blastn в Национальном центре биотехнологической информации (NCBI) [19].

    2.1.2. Анализ транскриптома ОАТ у грифов AWB.

    Для секвенирования следующего поколения суммарную РНК экстрагировали из указанной выше почки стервятника AWB и последовательности в Совете по сельскохозяйственным исследованиям (ARC) (Ондерстепорт, Претория, Южная Африка). кДНК секвенировали с использованием набора для подготовки цепочечных Ran мРНК Illuminia Truseq на химической модели Hiseq 2500 v4 2 x 125 пар оснований. В результате секвенирования было получено 50 миллионов коротких считываний длиной 125 нуклеотидов каждое. Последующий анализ был проведен на платформе Galaxy с использованием FASTQC [20], после чего адаптеры были удалены с помощью Trimmomatic [21].Предварительно обработанные чтения были собраны в транскрипты с помощью TRINITY [22]. Собранный транскриптом был преобразован в локальную базу данных Blast, и последовательности OAT1 и OAT2 были идентифицированы на основе предсказанных последовательностей из Golden Eagle OAT1 (XM_011601043.1) и OAT2 (XM_011585794.1). Беркут был выбран, поскольку было показано, что эти два вида тесно связаны [23].

    2.1.3. Подтверждение генов транскриптома AWB
    OAT1 и OAT2 с использованием секвенирования по Сэнгеру.

    Свежую тотальную РНК экстрагировали из ткани почек второго грифона AWB, чтобы предотвратить эффект накопления, с использованием набора Quick RNA Miniprep от Zymo Research (США). Синтез кДНК проводили с использованием набора Lunascript RT supermix kit от New England Biolabs (NEB) (США). Праймеры для OAT1 и OAT2 были сконструированы на основе последовательностей транскриптомов: OAT1 (F): GACCTTGTCTGCAGCTACCG; OAT1 (R): CCAGAGCTGCTTTATTCCTCCAAG; OAT2 (F): CTCATGTTGCTGCTCCTTAGTACA и OAT2 (R): CTAGGTGGACAGTAAAGGCTCTTT.ПЦР выполняли с использованием набора для полимеразы One taq от NEB. Протокол амплификации был следующим: начальная денатурация 94 ° C в течение 30 секунд, 40 циклов (денатурация 94 0 C в течение 30 секунд; отжиг 55 0 C в течение 30 секунд и удлинение 68 0 C в течение 2 минут) и окончательное удлинение 68 ° C в течение 5 мин. Очищенные продукты ПЦР секвенировали на генетическом анализаторе ABI 3500X1.

    2.1.4. Филогенетический анализ.

    Полученные прямые и обратные последовательности Сэнгера ОАТ стервятника AWB выравнивали с использованием Clustal Omega [24] для получения консенсусных последовательностей.Для построения филогенетического дерева из Genbank были извлечены 26 ( OAT1 ) и 39 ( OAT2 ) близкородственных видов птиц с более чем 85% сходством с грифом AWB OAT1 и OAT2 . Виды птиц, загруженные из Genbank (NCBI), принадлежат к следующим отрядам: Papaeognathae, Galoanseres, и большинство видов были Neoaves. Скачанные таксоны были сопоставлены с использованием мышечного алгоритма (программный пакет Molecular Evolutionary Genetics Analysis версия X (MEGA X) [25, 26]).После выравнивания пробелы были классифицированы как недостающие данные. Генетическое расстояние и статистика нуклеотидного состава всех таксонов были рассчитаны в версии MEGA X. Филогенетические отношения были построены с использованием оценки максимального правдоподобия (ML) модели Тамура-Неи и модели General Time Reversible [27, 28]. Для оценки узловой надежности был проведен бутстреп-анализ с 1000 повторениями топологий филогенетического дерева [29]. Инвентарные номера ОАТ (1 и 2) от различных видов птиц, включенных в филогенетическое древо, перечислены в (Таблица S1).

    2.2. Прогнозирующая функциональность белков

    2.2.1. Белковая местность.

    Перед инкубацией с первичными антителами был использован анализ последовательности, чтобы сначала показать сходство между сайтом связывания поликлонального кроличьего анти-OAT3 антитела (Whitehead Scientific, Южная Африка) и AWB OAT1, соответствующей последовательности иммуногена KKEEGERLSL EELKLNLQKE ISLAKAKYTA SDLFRIPMLR при 72% сходстве . Почки трехдневных самок мышей CD1 (n = 5) использовали в качестве контроля, поскольку последовательности OAT1 и не были зарегистрированы у цыплят.Почки сохранены иммерсионной фиксацией. Метод, описанный ранее в [30], был использован с некоторыми изменениями. Почки на короткое время перфузировали фосфатно-солевым буфером (PBS) при осмоляльности 298 мОсм / кг ч3O (pH 7,4) для удаления всей крови с последующей перфузией 2% -ным раствором периодат-лизин-параформальдегид (PLP) в течение 10 минут. После перфузии почки удаляли и разрезали на срезы (толщиной 1-2 мм), которые затем фиксировали погружением в тот же фиксатор на ночь при 4 ° C.После фиксации почки заливали воском и разрезали в поперечном направлении до толщины 4 мкм с помощью микротома. Срезы были обработаны для иммуногистохимии с использованием метода непрямой иммунной пероксидазы. Все срезы трижды промывали PBS, содержащим 50 мМ Nh5Cl, в течение 15 мин. Срезы сначала обрабатывали дозированной серией этанола, а затем инкубировали в течение 4 ч с раствором A (PBS, содержащий 1% бычий сывороточный альбумин (BSA), 0,05% сапонина и 0,2% желатина). После этого срезы тканей инкубировали в течение ночи при 4 ° C с антителами (1: 3000), разведенными в растворе A.

    После нескольких промывок в растворе B (PBS, содержащий 0,1% BSA, 0,05% сапонина и 0,2% желатина) срезы тканей инкубировали в течение 2 ч в конъюгированных с авидин-биотин-пероксидазой козьих анти-кроличьих IgG (H + L). Fab-фрагмент (White head Scientific, Южная Африка) разбавляли 1: 100 в растворе C (PBS, содержащий 1% BSA). Затем образцы промывали в растворе B, а затем в 0,05 М Трис-буфере (pH 7,6). Для обнаружения авидин-биотин-пероксидазы срезы инкубировали в 0,1% 3,3’диаминобензидине (DAB, Sigma) в 0.05 М Трис-буфер в течение 5 мин; Добавляли H 2 O 2 до конечной концентрации 0,01% и инкубацию продолжали в течение 10 минут. Срезы трижды промывали 0,05 М трис-буфером, дегидратировали с помощью этанола с постепенным изменением концентрации. Все образцы исследовали с помощью светового микроскопа.

    2.2.2. Анализ предсказания белка.

    Полученные последовательности OAT1 и OAT2 были преобразованы с помощью Expasy в белковые последовательности и установлена ​​открытая рамка считывания.После того, как выведенные аминокислотные последовательности были проанализированы с помощью следующих программ для предсказания трансмембранной спирали с использованием TMHMM [31] и PHYRE2 (механизм распознавания гомологии белков) с помощью Scan Prosite [32] для предсказания трехмерных структур и / или функциональности. Сайты гликозилирования N были предсказаны с использованием базы данных последовательностей PROTTER [33], а другие возможные сайты постгликозилирования и фосфорилирования были исследованы с помощью исследований базы данных Expasy. Транспортеры ОАТ были также проанализированы с помощью TrSSP (Сервер предсказания специфичности транспортеров субстратов) [34], чтобы установить, является ли предсказанный белок, вероятно, транспортером анионов.

    2.2.3. Экспрессия переносчика органических анионов 2.

    Для OAT2 , обратная транскриптаза (RT) -qPCR была выполнена на кДНК стервятника AWB и куриной кДНК (матрица), нацеленной на GAPDH (ген домашнего хозяйства) [35], и для отрицательного контроля матрица не добавлялась. с использованием специфических праймеров: курицаOAT2_F: ACCATCTCCACTGAGTGGGAC, курицаOAT2_R: CGGCCGAACCTGTCTGAAAG и стервятникOAT2_F: CATCTCCACGCAGTGGGAC, vultureOAT2_R: CGTCCGAACCTGTCTGAAAGG. Все реакции проводили на системе обнаружения ПЦР в реальном времени CFX96.Условия термоциклирования для RT-qPCR были следующими: 1 цикл при 95 ° C в течение 60 секунд, 40 циклов амплификации при 95 ° C в течение 15 секунд и отжиг при 60 ° C в течение 30 секунд. Среднее значение цикла количественного определения (Cq) определяли с использованием ручных настроек количественного определения и нормализовали с использованием значений GAPDH Cq. Использовалась следующая формула: нормализованный OAT2 Cq = OAT2 Cq — GAPDH Cq [35].

    2.2.4. Оценка докинга белков.

    На основании результата специфичности переносчика и гликозилирования N было выполнено прогнозируемое связывание лекарственного средства с OAT2 .Основной карман был оценен fPocket через платформу PHYRE2, поскольку большие карманы обычно считаются сайтами связывания. Аффинность специфического связывания диклофенака и уратов с транспортерами OAT2 курицы, стервятника или человека оценивали на молекулярном уровне в Swissdock с использованием шаблонной структуры, созданной PHYRE2, и запускали в автоматических настройках. Получили результирующую ΔG между уратом и диклофенаком и другими НПВП (мелоксикам, кетопрофен, карпрофен, нимесулид и толфенамовая кислота).Поскольку точка связывания диклофенака не известна, его сайт связывания был принят за точку с наивысшим сродством диклофенака или мочевой кислоты. Когда их соответствующие наиболее сильные сродства различались, определяли ΔG перекрывающегося связывания с использованием сайта связывания диклофенака в качестве вероятной точки прикрепления.

    3. Результаты

    3.1. Идентификация переносчиков ОАТ, присутствующих в стервятнике AWB, с использованием опубликованных праймеров, секвенирования нового поколения и Сэнгера

    Плохая амплификация была достигнута у стервятника AWB с использованием праймеров OAT3 , опубликованных Duda et al.(2005) [15]. В отличие от курицы, сгенерированная последовательность выровнена с опубликованной частичной последовательностью OAT3 (BBSRC Chick EST ID 603812145F1, 556bp) и обнаружила 97,11% сходство, что указывает на то, что праймеры амплифицировали правильный сегмент. Однако при бласт-анализе сгенерированная последовательность курицы была похожа только на последовательность OAT1 других видов птиц с наивысшим сходством 83% с Pelecanus crispus (далматинский пеликан) и 81,4% с Aquila chrysaetos (золотистый). eagle) без очевидного сходства с какой-либо опубликованной последовательностью курицы.Кроме того, в базе данных NCBI отсутствовала частичная последовательность цыпленка OAT3 . Более того, транспортер OAT3 , насколько мы могли установить, не был описан ни у одного вида птиц в базе данных NCBI. Это заставляет нас предположить, что праймеры, опубликованные в [15], скорее амплифицировали OAT1 . В последующем анализе внимание было уделено только OAT1 и OAT2 .

    В качестве следующего шага в анализе мы вернулись к полному анализу транскриптома.Используя извлеченную тотальную РНК и секвенирование следующего поколения, необработанные считывания (PRJNA560189) почечного образца были собраны в Trinity. Используя предсказанные золотым орлом последовательности для OAT1 и OAT2 в качестве эталона, последовательности AWB выровнены с первым со сходством 98,89 и 98,07% соответственно ( OAT1 -MN6; OAT2 -MN6). Эти последовательности впоследствии были подтверждены с помощью секвенирования по Сэнгеру (рис. 1) с хорошим сходством для OAT1 (MK854995) и OAT2 (MK879652) на 98.81 и 99,34% соответственно. Сходство последовательности Сэнгера с цыпленком OAT2 составляло 88,05% ( OAT1 у цыплят еще не идентифицировано).

    Рис. 1. Обычный ПЦР-амплифицированный ген OAT1 и OAT2 из почек стервятника AWB, продукт не был получен, когда матрица была опущена, размер молекулы (100 п.н.) указан слева.

    NTC = без управления шаблоном.

    https://doi.org/10.1371/journal.pone.0250408.g001

    3.2. Филогенетический анализ на основе последовательностей Сэнгера

    Анализ включал 26 и 39 нуклеотидных последовательностей, и в окончательном наборе данных было всего 1427 и 1626 позиций для OAT1 и OAT2 в указанном порядке. Сходство прежних видов представлено цифрами на внутренних узлах ветвей (рис. 2). Полученные деревья максимального правдоподобия для OAT1 и OAT2 выявили тесную взаимосвязь между стервятником AWB и таксонами орла, в то время как стервятник AWB и курица не имели одной и той же клады.

    Рис. 2.

    Реконструкция филогенетических отношений между генами (A) OAT1 и (B) OAT2 у видов птиц. Дискретное гамма-распределение использовалось для моделирования различий в скорости эволюции между сайтами (5 категорий (+ G, параметр = 0,5011 и 0,4500)) соответственно.

    https://doi.org/10.1371/journal.pone.0250408.g002

    3.3. Анализ функциональности белков и прогнозы

    3.3.1. Белковая местность.

    При наличии поликлональных антител кролика OAT3 это был первый шаг предпринятого функционального анализа.Для области связывания поликлонального антитела OAT3 мыши было 72,09% сходства с последовательностью Сэнгера стервятника OAT1 , была проведена иммуногистохимия для определения распределения OAT1 в почке AWB. Почки мыши использовали в качестве контроля, поскольку коммерческие поликлональные антитела, как ранее было показано, эффективны для мышей. Курица не была включена в этот анализ, поскольку последовательность OAT1 не присутствовала в базе данных NCBI для курицы.Световая микроскопия восковых срезов 4 мкм продемонстрировала иммуноокрашивание почки стервятника AWB в базолатеральной мембране проксимальных извитых канальцев (ПКТ) (рис. 3), что также наблюдалось для почки мыши. Некоторая иммунореактивность также наблюдалась на последних почках на клетках дистальных извитых канальцев и кортикальном собирательном канальце.

    3.3.2. Особенности белков-переносчиков.

    В последующем прогнозном анализе белка инструмент Expasy (protparam) предсказал, что белок AWB vulture OAT1 состоит из 449 аминокислот с молекулярной массой 44748.10, в то время как AWB vulture OAT2 состоял из 553 аминокислот с молекулярной массой 57281,49. Анализ доменов с помощью сканирования Prosite и Phyre2 предсказал, что эти белки связаны с мембранными транспортными белками, которые являются частью суперсемейства основных фасилитаторов (или семейства переносчиков растворенных веществ), которое транспортирует сахара и другие субстраты через клеточную мембрану. Для Phyre2 анализ домена по сравнению с аналогичным белком был представлен с достоверностью 100%. Функциональное предсказание с помощью TrSSP показало, что оба белка являются функциональными переносчиками анионов.База данных последовательностей PROTTER, использованная для предсказания сайтов гликозилирования N- , показала, что OAT1 имеет 10 предполагаемых трансмембранных спиралей и не содержит сайтов гликозилирования N как для беркута, так и для стервятника AWB. OAT2 имел 11 трансмембранных спиралей, состоящих из пяти N - сайтов гликозилирования, обнаруженных в положениях 31, 66, 73, 294, 330 для стервятника AWB, в то время как беркут имел 12 трансмембранных спиралей, а также 5 N сайтов гликозилирования в 68, 103, 110, 331, 3367.Трансмембранная топология предсказывала, что стервятник OAT1 AWB имел как внутриклеточную, так и внеклеточную петли, тогда как человеческий OAT1 содержал только одну внутриклеточную петлю. Гриф OAT2 состоял из одной внутриклеточной петли, как и цыпленок OAT2 (фиг. 4).

    Рис. 4.

    Прогнозируемый трехмерный и двумерный переносчик органических анионов 2 (OAT2) из ​​курицы (A) и африканского белоспинного стервятника (AWB) (B). Вставки - это идентифицированный главный карман (красный).Черная стрелка - это предполагаемый сайт (ы) связывания НПВП, который представляет собой только диклофенак для курицы и несколько НПВП для стервятника, для которых доступна информация о токсичности. Красные стрелки - это предполагаемые сайты связывания уратов. Предсказанная внутриклеточная петля курицы (C) и переносчик органических анионов AWB (D) 2. Графическое изображение (E) AWB OAT1, представляющего 10 трансмембранных спиралей и отсутствие сайтов мотивов N-гликана, и (F) AWB OAT2, представляющего 11 трансмембранных спиралей и 5 сайтов мотивов N-гликанов.

    https://doi.org/10.1371/journal.pone.0250408.g004

    3.4. Экспрессия AWB и цыпленка

    OAT2 с использованием ПЦР с обратной транскриптазой в реальном времени (RT-qPCR)

    Уровни экспрессии OAT2 определяли из AWB и образца почек цыпленка. Наблюдалась небольшая разница в пиках амплификации OAT2 между цыпленком и грифом AWB, экспрессируемыми в циклах 20,53 и 22,17 соответственно. Для устранения предвзятости кривая плавления после RT-qPCR гена домашнего хозяйства (GAPDH) была также оценена для обоих видов.Результаты кривой плавления для OAT2 обеих птиц подтвердили наличие небольшого различия. Нормализованные уровни экспрессии OAT2 для курицы и стервятника AWB наблюдались при циклах количественной оценки (cq) 6,609 и 6,947 соответственно.

    3,5. Анализ стыковки

    Для окончательного анализа мы попытались предсказать, как диклофенак будет взаимодействовать с транспортером OAT2 , предполагая отсутствие изменений в структуре белка при связывании. Предполагалось, что у каждого транспортера будет один большой карман.Свободная энергия связывания предсказала, что наиболее сильные сайты связывания для диклофенака и мочевой кислоты находятся в разных точках. Для мочевой кислоты это было ΔG -7,4 ккал / моль как для стервятника, так и для курицы и -6,2 ккал / моль для человека. Напротив, ΔG составляла -8,6, -6,8 и -7,7 ккал / моль для диклофенака, соответственно, для стервятника, курицы и человека. Если предположить, что связывание диклофенака происходит в фиксированном сайте, когда мочевая кислота перекрывается с этим конкретным сайтом, ΔG мочевой кислоты у стервятника и курицы составляет -5.5 и -5,7 ккал / моль соответственно. У людей не было перекрывающихся участков. По сравнению с другими НПВП; мелоксикам, кетопрофен, карпрофен, нимесулид и толфенамовая кислота имеют общий сайт связывания с ΔG -7,53, -8,32, -7,47, -8,24 и -7,7 ккал / моль (рис. 4). Однако это интересное открытие требует дальнейшей оценки.

    4. Обсуждение

    Поскольку токсичность диклофенака для стервятников была связана со значительным увеличением концентрации мочевой кислоты в плазме, следующее исследование было сосредоточено на идентификации органических анионных переносчиков, присутствующих в почках стервятника, с использованием методов молекулярной биологии и начиная с информации, доступной для курицы и курицы. млекопитающие.В результате неожиданного открытия, хотя частичный транскрипт OAT3 и был успешно идентифицирован у цыплят, как описано Dudas et al. (2005) [15], для стервятника амплификации достигнуто не было. Кроме того, бласт-анализ продемонстрировал сходство только частичного транскрипта курицы с генами OAT1 других видов птиц, но не с транскриптомом курицы. Это привело к заключению, что OAT3 -подобная частичная последовательность, ранее идентифицированная у кур, вероятно, была неправильно классифицирована и что исследование, вероятно, идентифицировало OAT1 .Также, насколько нам удалось выяснить, OAT3 не были идентифицированы у птиц ни в каких других исследованиях. Также неизвестно, почему частичные последовательности OAT1 , идентифицированные для курицы, не присутствовали в базе данных NCBI, и почему не сообщается, что OAT1 встречается у цыплят. Вероятно, это указывает на то, что OAT2 является единственным функционально экспрессируемым в организме курицы. OAT2 , как было обнаружено, экспрессируется по-разному, а также был идентифицирован как высоко экспрессируемый у мышей.

    Для дальнейшей оценки OAT, присутствующих в почке стервятника, секвенирование следующего поколения и сборка Trinity выявили присутствие OAT1 с 1468 п.н. и OAT2 с генами 2300 п.н., оба с более чем 98% похожими на беркут. Это было впоследствии подтверждено секвенированием по Сэнгеру как 1350 п.н. и 1662 п.н. для транспортеров OAT1 и OAT2 соответственно, с до 99% сходства с последовательностями, собранными с помощью NGS. Очевидная разница, вероятно, была результатом использования для анализа разных птиц.Последующий филогенетический анализ показал большое разнообразие переносчиков ОАТ, описанных до сих пор у различных видов птиц, что может быть связано с эволюцией, мутациями; гендер и окружающая среда. Разнообразие в последовательности, вероятно, также объясняет, почему куриный праймер [15] не амплифицировал ген стервятника OAT3 / OAT1 . Тем не менее, переносчик ОАТ был более консервативен в семействе Accipitrid (стервятники и клады орлов), что неудивительно из-за сходства в питании и чувствительности к диклофенаку, как у степного орла ( Aquila nipalensis ).Пока что в естественных условиях степные орлы являются единственным видом, не являющимся грифом, который также чувствителен к действию диклофенака [36]. В своем исследовании Sharma et al. (2014) [36] пришли к выводу, что диклофенак может быть токсичным для других хищников Accipitrid. Исходя из этого результата, можно утверждать, что филогения генов OAT1-2 у видов птиц может быть полезна при построении прогностической модели, если гены OAT1 и OAT2 могут быть секвенированы у рассматриваемых видов. Хотя потребуется дальнейшая оценка, если такая связь действительно существует, она принесет огромную пользу в будущих исследованиях токсичности, поскольку суррогатные виды, не находящиеся под угрозой исчезновения, могут ускорить текущие исследования, направленные на оценку токсичности других НПВП.

    Затем, чтобы понять функциональность идентифицированных белков OAT, был проведен ряд оценок. По возможности сравнивали с цыплятами, поскольку этот вид является наиболее изученным птицем с точки зрения экскреции мочевой кислоты, а также по еще не объясненной причине, поскольку вид также подвержен токсическому эффекту диклофенака. Для первой из этих оценок местоположение переносчика ОАТ определяли с помощью иммуногистохимии. Для этого мы использовали коммерческие поликлональные антитела OAT3 , описанные для мыши, поскольку доступные антитела показали хорошее перекрытие с последовательностью OAT1 стервятника 72% .Кроме того, использовали поликлональные клетки, поскольку они с большей вероятностью связывались с нецелевыми видами. После окрашивания распределение транспортера OAT1 было локализовано в проксимальном извитом канальце. Этот результат согласуется с предыдущими исследованиями, показывающими, что OAT1 локализуется на базолатеральной мембране проксимальных извитых канальцевых клеток у др. Видов [17, 37-39]. Хотя антитела OAT2 и не присутствовали для подобной оценки, у нас нет оснований полагать, что их распределение будет отличаться от OAT1 , поскольку два белка экспрессируются вместе одной и той же клеткой у других видов [7, 11, 12] .

    Для следующего шага мы выяснили, будет ли транспортер эффективен в своей области экспрессии с помощью моделирования in silico . Хотя моделирование показало, что OAT1 и OAT2 являются белками-переносчиками, мы полагаем, что только OAT2 является переносчиком анионов, т.е. OAT1 может не быть функциональным переносчиком. Мы основывали свой вывод на отсутствии сайтов гикозилирования для OAT1 , которые присутствовали для OAT2 .Исследования Tanaka et al. (2004) [40], показали, что, хотя гликозилирование не влияет на функциональность белка, оно играет важную роль в прикреплении белка к плазматической мембране, т.е. эти белки обычно находятся внутри внутриклеточных везикул и должны перемещаться. / перемещаются к клеточной мембране, чтобы стать функциональным, что маловероятно в отсутствие сайтов гликозилирования. В своих исследованиях Tanaka et al. (2004) и Zhou et al. (2005) [40, 41] смогли продемонстрировать, что удаление всех сайтов гликозилирования привело к тому, что транспортеры (человеческий OAT1 и OAT4 ) оказались захваченными во внутриклеточном компартменте, где они стали неэффективными из-за своего местоположения.Используя это открытие, вероятно, что OAT1 неактивен в качестве переносчика у стервятника, или, что еще более вероятно, предсказанная последовательность для орла не является действительно переносчиком OAT1 . Последнее может также объяснить, почему анализ in silico с TrSSP не предсказал анионной активности для этого белка и, возможно, почему OAT1 еще не идентифицирован у цыплят. Однако для подтверждения этого открытия следует провести исследования транспорта органических анионов в присутствии специфических ингибиторов отдельных транспортных белков ОАТ с использованием анализов клонирования in vitro.

    Для OAT2 , считающегося функциональным белком, последним шагом было определение уровня экспрессии белка по сравнению с цыпленком. Хотя RT-qPCR смогла подтвердить, что OAT2 экспрессируется на одинаковом уровне как у курицы, так и у стервятника, уровень экспрессии, скорректированный геном домашнего хозяйства, показывает, что экспрессия между видами различалась в 1,3 раза, что, вероятно, важный вывод. При сравнении стервятника и курицы оба вида чувствительны к токсическому воздействию однократной дозы диклофенака.Однако курица менее чувствительна с зарегистрированной LD50 (средняя летальная доза) около 10 мг / кг, в то время как LD50 для AWB составляла около 0,8 мг / кг [1, 42–44]. Небольшая разница в экспрессии может быть определяющим признаком различий в восприимчивости видов к токсичности. Более того, 12-кратное различие в LD50 также можно объяснить различиями в аминокислотной последовательности ОАТ, а также вариабельным взаимодействием диклофенака с ОАТ2 у обоих видов. В качестве следующего шага было бы интересно сравнить экспрессию OAT2 у стервятника с видами, которые слабо восприимчивы к токсическому действию диклофенака, такими как утка ( Anas platyrhynchos ) или голубь ( Columbidae ) [45] .

    5. Заключение

    В этом исследовании мы пришли к выводу, что почка стервятника AWB экспрессирует мРНК OAT1 и OAT2 , но не OAT3 . Кроме того, с помощью моделирования insilico, предсказывающего, что у белка OAT1 отсутствуют сайты гликозилирования, возникают сомнения относительно эффективности OAT1 в качестве переносчика. Это наводит на мысль, что OAT2 , вероятно, является основным переносчиком мочевой кислоты у грифов AWB. Кроме того, исследования экспрессии, показывающие небольшие различия в уровнях экспрессии OAT2 у курицы и стервятника, могут объяснить незначительные различия в чувствительности к диклофенаку между этими двумя видами.Чтобы усилить результаты, приведенные выше, необходимо провести другие исследования, чтобы выяснить, где транспортер OAT2 функционирует на базолатеральной мембране.

    Благодарности

    Исследование также стало возможным благодаря поддержке VulPro, которая предоставила стервятников, и UPBRC, которая получила ткани мышей и курицы.

    Ссылки

    1. 1. Oaks JL, Gilbert M, Virani MZ, Watson RT, Meteyer CU, Rideout BA и др. Остатки диклофенака как причина сокращения популяции стервятников в Пакистане.Природа. 2004 февраль; 427 (6975): 630–3. pmid: 14745453
    2. 2. Найду В., Лебедь Г.Е. Токсичность диклофенака у грифов-стервятников связана со снижением экскреции мочевой кислоты, а не с почечной портальной вазоконстрикцией. Сравнительная биохимия и физиология, часть C: токсикология и фармакология. 2009, 1 апреля; 149 (3): 269–74. pmid: 18727958
    3. 3. Сканы CG, редактор. Птичья физиология Стурки. Эльзевир; 2014, 30 июня. Https://doi.org/10.1371/journal.pone.0093649 pmid: 24733125
    4. 4.Maesaka JK, Fishbane S. Регулирование почечной экскреции уратов: критический обзор. Американский журнал болезней почек. 1998, 1 декабря; 32 (6): 917–33. pmid: 9856507
    5. 5. Sweet DH, Pritchard JB. Молекулярная биология почечных переносчиков органических анионов и органических катионов. Биохимия и биофизика клетки. 1999, 1 февраля; 31 (1): 89–118. pmid: 10505670
    6. 6. Павлова А, Сакураи Х, Леклерк Б., Байер Д.Р., Ю.А.С., Нигам СК. Регулируемая в процессе развития экспрессия переносчиков органических ионов NKT (OAT1), OCT1, NLT (OAT2) и Roct.Американский журнал физиологии-физиологии почек. 2000, 1 апреля; 278 (4): F635–43. pmid: 10751225
    7. 7. Ванверт А.Л., Гионфриддо MR, Sweet DH. Органические переносчики анионов: открытие, фармакология, регулирование и роль в патофизиологии. Биофармацевтика и утилизация лекарств. 2010 Янв; 31 (1): 1–71.
    8. 8. Буркхардт Г. Транспорт лекарств переносчиками органических анионов (ОАТ). Фармакология и терапия. 2012 г., 1 октября; 136 (1): 106–30.
    9. 9. Смитс PH, ван Обель Р.А., Воутерс А.С., ван ден Хеувел Дж.Дж., Рассел Ф.Г.Вклад белка 2 множественной лекарственной устойчивости (MRP2 / ABCC2) в почечную экскрецию п-аминогиппурата (ПАУ) и идентификация MRP4 (ABCC4) как нового переносчика ПАУ. Журнал Американского общества нефрологов. 1 ноября 2004 г.; 15 (11): 2828–35. pmid: 15504935
    10. 10. Шин Х.Дж., Такеда М., Эномото А., Фудзимура М., Миядзаки Х., Анзай Н. и др. Взаимодействие уратного транспортера URAT1 в почках человека с урикозурическими препаратами. Нефрология. 2011 Февраль; 16 (2): 156–62. pmid: 21272127
    11. 11.Сладкий DH. Члены семейства переносчиков органических анионов (Slc22a) как медиаторы токсичности. Токсикология и прикладная фармакология. 2005 1 мая; 204 (3): 198–215. pmid: 15845414
    12. 12. Сладкий DH. Почечный транспорт органических катионов и анионов: от физиологии к генам. 2010; 23–53.
    13. 13. Burckhardt BC, Burckhardt G. Транспорт органических анионов через базолатеральную мембрану клеток проксимальных канальцев. В Обзоре физиологии, биохимии и фармакологии 2003 г. (стр.95–158). Шпрингер, Берлин, Гейдельберг. https://doi.org/10.1007/s10254-002-0003-8 pmid: 12605306
    14. 14. Cuthbert R, Green RE, Ranade S, Saravanan S, Pain DJ, Prakash V и др. Быстрое сокращение популяции египетского стервятника (Neophron percnopterus) и рыжего стервятника (Sarcogyps calvus) в Индии. Сохранение животных. 2006 август; 9 (3): 349–54.
    15. 15. Дудас П.Л., Пелис Р.М., Браун Э.Дж., Ренфро Дж.Л. Трансэпителиальный транспорт уратов эпителием проксимальных канальцев почек птиц в первичной культуре.Журнал экспериментальной биологии. 2005 15 ноября; 208 (22): 4305–15. pmid: 16272253
    16. 16. Long S, Skadhauge E. Выделение почечной кислоты у домашней птицы. Журнал экспериментальной биологии. 1 мая 1983 г., 104 (1): 51–8.
    17. 17. Синклер, доктор медицины, Мили К.Л., Мэтьюз Н.С., Пек К.Э., Тейлор Т.С., Беннетт Б.С. Сравнительная фармакокинетика мелоксикама у клинически здоровых лошадей и ослов. Американский журнал ветеринарных исследований. 2006 июнь; 67 (6): 1082–5. pmid: 16740106
    18. 18.Бергер Л., Юй Т.С., Гутман А.Б. Влияние препаратов, изменяющих экскрецию мочевой кислоты у человека, на клиренс мочевой кислоты у цыплят. Американский журнал физиологии - наследие. 1 марта 1960 г., 198 (3): 575–80.
    19. 19. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д.. Базовый инструмент поиска локального выравнивания. Журнал молекулярной биологии. 5 октября 1990 г., 215 (3): 403–10. pmid: 2231712
    20. 20. Эндрюс С.Ф., Крюгер Ф., Секундс-Пишон А., Биггинс Ф., Уингетт Ф. Инструмент контроля качества для данных последовательности с высокой пропускной способностью.Бабрахам Биоинформатика. 2014. pmid: 25494900
    21. 21. Bolger AM, Lohse M, Usadel B. Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика. 2014 1 августа; 30 (15): 2114–20. pmid: 24695404
    22. 22. Грабхерр М.Г., Хаас Б.Дж., Яссур М., Левин Дж.З., Томпсон Д.А., Амит И. и др. Сборка полноразмерного транскриптома из данных RNA-Seq без эталонного генома. Биотехнология природы. Июль 2011 г .; 29 (7): 644–52. pmid: 21572440
    23. 23. Адаварен Э.O., Du Plessis M., Suleman E., Kindler D., Oosthuizen A.O., Mukandiwa L. и др. 2020. Полный митохондриальный геном копротер Gyps (Aves, Accipitridae, Accipitriformes): филогенетический анализ митогенома среди хищных птиц. PeerJ , 8, p.e10034. pmid: 33240589
    24. 24. Сиверс Ф., Вильм А., Дайнин Д., Гибсон Т. Дж., Карплюс К., Ли В. и др. Быстрое и масштабируемое создание высококачественного выравнивания множественных последовательностей белков с помощью Clustal Omega. Молекулярная системная биология. 2011; 7 (1): 539.pmid: 21988835
    25. 25. Кумар С., Стечер Г., Ли М., Князь С., Тамура К. MEGA X: анализ молекулярной эволюционной генетики на вычислительных платформах. Молекулярная биология и эволюция. 1 июня 2018 г .; 35 (6): 1547–9. pmid: 29722887
    26. 26. Эдгар Р.С., Бацоглу С. Множественное выравнивание последовательностей. Современное мнение в структурной биологии. 2006 г., 1 июня; 16 (3): 368–73. pmid: 16679011
    27. 27. Тамура К., Неи М. Оценка количества замен нуклеотидов в контрольной области митохондриальной ДНК у людей и шимпанзе.Молекулярная биология и эволюция. 1993 1 мая; 10 (3): 512–26. pmid: 8336541
    28. 28. Неи М., Кумар С. Молекулярная эволюция и филогенетика. Издательство Оксфордского университета; 2000 27 июля.
    29. 29. Фельзенштейн Дж. Пределы уверенности в филогении: подход, использующий бутстрап. эволюция. Июль 1985 г., 39 (4): 783–91. pmid: 28561359
    30. 30. Hwang JS, Park EY, Kim WJ, Yang CW, Kim J. Экспрессия OAT1 и OAT3 в дифференцировке проксимальных канальцев почки мыши.Гистология и гистопатология. 2010. pmid: 19924639
    31. 31. Krogh A, Larsson B, Von Heijne G, Sonnhammer EL. Прогнозирование топологии трансмембранного белка с помощью скрытой марковской модели: приложение для полных геномов. Журнал молекулярной биологии. 2001, 19 января; 305 (3): 567–80. pmid: 11152613
    32. 32. Келли Л.А., Мезулис С., Йейтс С.М., Васс М.Н., Штернберг М.Дж. Веб-портал Phyre2 для моделирования, прогнозирования и анализа белков. Протоколы природы. 2015 июн; 10 (6): 845–58. pmid: 25950237
    33. 33.Sigrist CJ, Cerutti L, Hulo N, Gattiker A, Falquet L, Pagni M и др. PROSITE: документированная база данных, использующая шаблоны и профили в качестве дескрипторов мотивов. Брифинги по биоинформатике. 2002, сентябрь 1; 3 (3): 265–74. pmid: 12230035
    34. 34. Мишра Н.К., Чанг Дж., Чжао П.Х. Прогнозирование белков мембранного транспорта и их субстратной специфичности с использованием информации о первичной последовательности. ПлоС один. 2014 26 июня; 9 (6): e100278. pmid: 24968309
    35. 35. Олиас П., Адам I, Мейер А., Шарфф С., Грубер А.Д.Контрольные гены для количественных исследований экспрессии генов у нескольких видов птиц. ПлоС один. 2014, 13 июня; 9 (6): e99678. pmid: 24926893
    36. 36. Шарма А.К., Шайни М., Сингх С.Д., Пракаш В., Дас А., Дасан РБ и др. Диклофенак токсичен для степного орла Aquila nipalensis: расширение разнообразия хищных птиц, которым угрожает злоупотребление НПВП, в Южной Азии. Международная организация по охране птиц. 2014 Сен; 24 (3): 282–6.
    37. 37. Sweet DH, Wolff NA, Pritchard JB. Клонирование экспрессии и характеристика ROAT1 Базолатерального переносчика органических анионов в почках крысы.Журнал биологической химии. 1997, 28 ноября; 272 (48): 30088–95. pmid: 9374486
    38. 38. Лу Р, Чан Б.С., Шустер В.Л. Клонирование переносчика ПАУ в почках человека: узкая субстратная специфичность и регуляция протеинкиназой С. Американский журнал физиологии-почечной физиологии. 1999, 1 февраля; 276 (2): F295–303. pmid: 9950961
    39. 39. Race JE, Grassl SM, Williams WJ, Holtzman EJ. Молекулярное клонирование и характеристика двух новых переносчиков органических анионов почек человека (hOAT1 и hOAT3).Сообщения о биохимических и биофизических исследованиях. 1999 16 февраля; 255 (2): 508–14. pmid: 10049739
    40. 40. Танака К., Сюй В., Чжоу Ф., Ю Г. Роль гликозилирования в транспортере органических анионов OAT1. Журнал биологической химии. 2004, 9 апреля; 279 (15): 14961–6. pmid: 14749323
    41. 41. Чжоу Ф., Сюй В., Хун М., Пан З., Синко П.Дж., Ма Дж. И др. Роль N-связанного гликозилирования в сворачивании белка, нацеливании на мембрану и связывании субстрата человеческого органического переносчика анионов hOAT4.Молекулярная фармакология. 1 марта 2005 г .; 67 (3): 868–76. pmid: 15576633
    42. 42. Green RE, Newton IA, Shultz S, Cunningham AA, Gilbert M, Pain DJ и др. Отравление диклофенаком как причина сокращения популяции стервятников на Индийском субконтиненте. Журнал прикладной экологии. 2004 Октябрь; 41 (5): 793–800. pmid: 15801603
    43. 43. Swan GE, Cuthbert R, Quevedo M, Green RE, Pain DJ, Bartels P и др. Токсичность диклофенака для грифов. Письма биологии. 2006 22 июня; 2 (2): 279–82.pmid: 17148382
    44. 44.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *