Испытательная колодка икк: Испытательная клеммная коробка (ИКК) купить в Москве по оптовой цене | TM ELECTRIC — работаем с 1994 года

Содержание

ИКК - это... Что такое ИКК?

ИКК

иммунокомпетентные клетки

мед.

ИКК

измерительный комплекс космодрома

косм.

Словари: Словарь сокращений и аббревиатур армии и спецслужб. Сост. А. А. Щелоков. — М.: ООО «Издательство АСТ», ЗАО «Издательский дом Гелеос», 2003. — 318 с., С. Фадеев. Словарь сокращений современного русского языка. — С.-Пб.: Политехника, 1997. — 527 с.

ИКК

Интернациональная контрольная комиссия

Коминтерна

  1. ИКК
  2. ИКТ

информационно-коммуникационная компетентность

образование и наука

  1. ИКК

Источник: http://www.ict.edu.ru/news/conferences/1681

ИКК

Инвестиционная корпорация Китая

КНР, организация, фин.

Источник: http://www.ng.ru/world/2011-05-24/7_china.html

ИКК

испытательная клеммная коробка

техн.

ИКК

исследовательский коррозионно-метрический комплекс

Источник: www. neftegaz.ru/catalog/product/1160237/

ИКК

интерстициальные клетки Кэйждела

биол.

Источник: www.kentos.ru/Medicine/25555.htm

ИКК

искусственный кристалл кварца

Словарь сокращений и аббревиатур. Академик. 2015.

Характеристики и комплектация клеммных коробок


Основные характеристики


Коробки У614, У615 и КЗНС - являются полными аналогами коробок КС10, КС20, КС40, КК10, КК20, КК40, КЗН 08/16/32/48.

Коробки клеммные предназначены для соединения и разветвления вторичных и силовых цепей выполняемых контрольными кабелями с числом жил до 48 и силовыми кабелями с алюминиевыми и медными жилами сечением 1,5-6 мм2. Корпус коробки изготавливается из металла и имеет защитное лакокрасочное покрытие, что обеспечивает коробкам высокие показатели надежности и долговечности. Со стороны дна на коробках имеются ушки , предназначенные для их крепления к строительным конструкциям с помощью крепежных изделий или сваркой. На боковых поверхностях находятся ушки для выполнения видимого заземления. Герметизация соединения крышки и корпуса обеспечивается уплотнительной прокладкой. Коробки имеют различную степень защиты по IP в зависимости от используемых кабельных вводов.

В коробку установлены съемные клеммные блоки, каждая клемма промаркирована для облегчения правильности разводки проводов. Блоки жестко фиксируются на рейке винтами. Клеммная колодка соответствует ГОСТ 19132-86.

Технические характеристики Тип коробок
У614 У615 КЗНА КЗНС
Климатическое исполнение У2 У3 У2
Изготавливается по ТУ 3434-002-01395331-2006
Степень защиты c металлическими сальниками IP65
Степень защиты c пластмассовыми сальниками
IP54
Степень защиты без сальников IP31
Напряжение переменного тока частотой 50 Гц до 660 В
Номинальный ток наборных зажимов 16А
Напряжение постоянного тока до 440 В
Сечение жил от 1,5 до 6 мм2
Количество зажимов 10 20 8/16/32/48 8/16/32/48
Материал изготовления Cталь с порошковым покрытием

 


Монтаж и габаритные размеры


Коробки клеммные КЗНА и КЗНС различаются только наличием у КЗНС сальников, в зависимости от условий эксплуатации вы можете выбрать как КЗНА с заглушками, так и КЗНС с сальниками.

Коробки КЗНС выпускаются в двух модификациях - с латунными (металлический кабельный ввод) или пластмассовыми сальниками. Под заказ комплект сальников может быть изменен.

Коробки У614 и У615 имеют полный комплект установленных латунных или пластмассовых сальников во все предусмотренные отверстия.

Тип Общее кол-во отверстий Диаметр (D) и количество (K) отверстий
D K D K D K D K D K
У614 4 19,2 2 23,2 1 31,5 1 - - - -
У615 7 19,0 2 23,2 3 31,5 2 - - - -
КЗН 08
5 - - 23,2 4 31,5 1 - - - -
КЗН 16 7 - - 23,2 6 31,5 1 - - - -
КЗН 32 10 - - 23,2 7 31,5 2 43,3 1 - -
КЗН 48 12 - - 23,2 8 31,5 2 43,3 1 49,2 1
Типы кабельных
вводов под отверстие
Сальник М19
Сальник У261
Сальник М22
Сальник У262
Мвпнг 15
У475
МВ 15
РКН 15
Сальник М30
Сальник У263
Мвпнг 25
Сальник М42
Сальник У667
МВ 32
Сальник М48
Сальник У668
МВ 38
У478
Габаритные размеры
КЗН-08 КЗН-16 КЗН-32 КЗН-48 У614 У615

 


Комплектация


Тип коробок Комплектация, шт.
Латунные сальники Пластмассовые сальники Заглушки
M19 M22 M30 M42 M48 PG11 PG16 PG19 PG24
КЗНС 08 - 2 1 - - - 2 - 1 2
КЗНС 16
- 3 1 - - - 3 - 1 3
КЗНС 32 - 3 2 1 - - - - - 4
КЗНС 48 - 4 1 1 1 - - - - 5
КЗНА 08/16/32/48 - - - - - - - - - Все отверстия
У614 2 1 1 - - 2 - 1 1 -
У615 2 3 2 - - 2 - 3 2 -

0524300002517000003 Поставка электротехнической продукции

Наименование Кол-во Цена за ед. Стоимость, ₽

Основание светильника НББ

ОКПД2 27. 40.42.000   Части светильников и осветительных устройств

100 шт

22,70

2 270,00

Рассеиватель света

ОКПД2 27.40.42.000   Части светильников и осветительных устройств

100 шт

42,37

4 237,00

Стартер

ОКПД2 27.40.42.000   Части светильников и осветительных устройств

25 шт

18,66

466,50

Фотореле уличное

ОКПД2 27. 12.24.190   Реле прочие

1 шт

219,60

219,60

ЭПРА 2×18Вт

ОКПД2 27.12.40.000   Части электрической распределительной или регулирующей аппаратуры

5 шт

256,32

1 281,60

Патрон керамический

ОКПД2 27.33.12.000   Патроны для ламп на напряжение не более 1 кВ

50 шт

10,19

509,50

Патрон карболитовый

ОКПД2 27. 33.12.000   Патроны для ламп на напряжение не более 1 кВ

50 шт

26,31

1 315,50

Дроссель

ОКПД2 27.33.13.164   Усилители магнитные и дроссели управляемые

2 шт

826,64

1 653,28

Автоматический выключатель ВА47-29

ОКПД2 27.12.22.000   Выключатели автоматические на напряжение не более 1 кВ

24 шт

88,65

2 127,60

Автоматический выключатель ВА47-29

ОКПД2 27. 12.22.000   Выключатели автоматические на напряжение не более 1 кВ

24 шт

93,34

2 240,16

Автоматический выключатель ВА47-29

ОКПД2 27.12.22.000   Выключатели автоматические на напряжение не более 1 кВ

120 шт

88,65

10 638,00

Автоматический выключатель ВА47-29

ОКПД2 27.12.22.000   Выключатели автоматические на напряжение не более 1 кВ

72 шт

93,34

6 720,48

Автоматический выключатель ВА47-29

ОКПД2 27. 12.22.000   Выключатели автоматические на напряжение не более 1 кВ

2 шт

280,28

560,56

Автоматический выключатель ВА47-29

ОКПД2 27.12.22.000   Выключатели автоматические на напряжение не более 1 кВ

2 шт

280,28

560,56

Вилка электрическая

ОКПД2 27.12.40.000   Части электрической распределительной или регулирующей аппаратуры

5 шт

34,78

173,90

Вилка электрическая

ОКПД2 27. 12.40.000   Части электрической распределительной или регулирующей аппаратуры

5 шт

110,70

553,50

DIN-рейка

ОКПД2 25.11.23.120   Конструкции и детали конструкций из алюминия прочие

20 шт

68,50

1 370,00

Коробка У192

ОКПД2 27.12.40.000   Части электрической распределительной или регулирующей аппаратуры

50 шт

23,27

1 163,50

Коробка У195

ОКПД2 27. 12.40.000   Части электрической распределительной или регулирующей аппаратуры

50 шт

15,72

786,00

Пломбы для электросчетчиков свинец

ОКПД2 24.43.21.120   Полосы и ленты свинцовые

0,42 кг

226,67

95,20

Счетчик в круглом корпусе

ОКПД2 26.51.63.130   Счетчики производства или потребления электроэнергии

8 шт

768,28

6 146,24

Трансформатор тока

ОКПД2 27. 11.42.000   Трансформаторы прочие мощностью не более 16 кВА

9 шт

639,68

5 757,12

Трансформатор тока

ОКПД2 27.11.42.000   Трансформаторы прочие мощностью не более 16 кВА

3 шт

634,21

1 902,63

Коробка испытательная переходная ИКК

ОКПД2 27.12.40.000   Части электрической распределительной или регулирующей аппаратуры

1 шт

248,91

248,91

ПАР 16А УХЛ4

ОКПД2 27. 12.21.000   Предохранители плавкие на напряжение не более 1 кВ

10 шт

109,55

1 095,50

Основание (держатель) для ПАР 16А УХЛ4

ОКПД2 27.12.40.000   Части электрической распределительной или регулирующей аппаратуры

10 шт

16,96

169,60

Предохранитель

ОКПД2 27.12.21.000   Предохранители плавкие на напряжение не более 1 кВ

100 шт

77,81

7 781,00

Предохранитель

ОКПД2 27. 12.21.000   Предохранители плавкие на напряжение не более 1 кВ

40 шт

69,27

2 770,80

Кабель АВВГ-П 2*2,5

ОКПД2 27.32.13.112   Кабели силовые с алюминиевой жилой на напряжение до 1 кВ

300 м

9,70

2 910,00

Кабель ВВГ-П 3*1,5

ОКПД2 27.32.13.111   Кабели силовые с медной жилой на напряжение до 1 кВ

50 м

27,25

1 362,50

Кабель ВВГ-П 3*2,5

ОКПД2 27. 32.13.111   Кабели силовые с медной жилой на напряжение до 1 кВ

50 м

41,43

2 071,50

Провод АПВ-6

ОКПД2 27.32.11.000   Провода обмоточные изолированные

200 м

5,75

1 150,00

Провод ПВС 2х2,5

ОКПД2 27.32.11.000   Провода обмоточные изолированные

50 м

38,54

1 927,00

Провод ПВ1

ОКПД2 27. 32.11.000   Провода обмоточные изолированные

10 м

6,56

65,60

Клипса

ОКПД2 22.29.29.190   Изделия пластмассовые прочие, не включенные в другие группировки

100 шт

1,88

188,00

Клипса

ОКПД2 22.29.29.190   Изделия пластмассовые прочие, не включенные в другие группировки

100 шт

1,63

163,00

Изолента ПВХ

ОКПД2 22. 21.42.141   Покрытия полимерные защитные изолирующие, локализирующие, дезактивирующие и аккумулирующие

30 шт

45,80

1 374,00

Кабель-канал 25х16

ОКПД2 27.90.12.130   Трубки изоляционные для электропроводки

40 м

23,90

956,00

Печь электрическая ПЭТ-4

ОКПД2 27.51.26.110   Приборы отопительные электрические

2 шт

773,73

1 547,46

Батарея аккумуляторная никель-металлогидридная

ОКПД2 27. 20.23.120   Батареи аккумуляторные никель-металл-гидридные

4 шт

94,08

376,32

BAY 11-7082 | ≥99% (ВЭЖХ) | Селлек

N2] ] N2 N
HeLa NGHwNGFHfW6ldHnvckBCe3OjeR? = MYqxNOKh | рыП NULrepVLOS53IHi = MVLhZo9tcXOqZYOgRnBCKGmwZIXj [YQhfXBicnXneYxifGmxbjDv [kBHViCjbnSgUW1RNToEoB? = MnXCQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjV5OUe0N | coRjJ3RC 9000: jOPh ?4
SiHa NUD3OopbTnWwY4Tpc44hSXO | YYm = NXrSVXVbOTEEoN88US => МмК1НУ42КГх? MoS0ZYJwdGm | aHXzJGJRSSCrbnT1Z4VlKHWyIILl [5Вт [XSrb36gc4YhTk5iYX7kJG1OWC17wrC = M4TNSVxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ3N {m3OFM4Lz5 {NUez5O |
ARPE-19 Mlv6SpVv [3Srb36gRZN {[Xl? MoXGNUDPxE1? МнТвНЕ42КГх? MX3zeZBxemW | c3XzJHRINWmwZIXj [YTDqEmOLUlCpJBzd22xdHXyJIFkfGm4YYTpc44> NUmzfnVpRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkW1PVMxOjlp>
HCT116 MVvGeY5kfGmxbjDBd5NigQ>? MYq1JO69VQ>? NV; RPILEOICQ M4C5RmROW09? MU \ heJRmdnWjdHXzJJNqdHmvYYLpck1qdmS3Y3XkJIRwf26 {ZXf1cIF1cW: wIH; mJIN6 [2yrbjDENS => МВт [8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPTR5OUeyN {c, OjV2N {m3NlM9N2F
HMEC NWLUR4x6TnWwY4Tpc44hSXO | YYm = NHjQXWY2yqEQvF2 = MX2yJIg> MlTwZYJwdGm | aHXzJHRPTi4QsT3pcoR2 [2WmIG \ DRW0uOSCneIDy [ZN {cW: wwrC = NIHkO209 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NUG5N | EyPid-MkWZ000: L1
A549 MWjGeY5kfGmxbjDBd5NigQ>? NV7PXHhxOTEkgJpCuW0> NVXKXWFbOTJiaB? = NITGOWR {fXCycnXzd4V {KES4bD2zJIlv \ HWlZXSgZYN1cX [jdHnvckBw \ iCyNkW = M3H0S | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ3MUW2PFAxLz5 {NUG1Olg]
RAW 264. 7 NEn1NotHfW6ldHnvckBCe3OjeR? = NUD1PIJuPcLizszN NXLFeY5WOSCq MXXpcohq [mm2czDUUmYu | rFiYX7kJGlNNTF {IIC0NEBxem: mdXP0bY9v MnLaQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjVyMUm1OlcoRjJ3MEG5OVY4 =
макрофаги M {nSb2Z2dmO2aX; uJGF {e2G7 MmrkOUDDvU1? NHXGdIs {KGh? NIi4ZXhx [XK2aXHscJkh [myxY3vzJHlRTlNvaX7keYNm \ CCneIDy [ZN {cW: wIH; mJIlPV1NiYX7kJGNQYC1 {wrC = NUfwWW0 {RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkS5Olc5QThpP4000; hQlPVi]
HUVEC M1PFSmZ2dmO2aX; uJGF {e2G7 NEfpWIU {NTNyIN88US => MWWxJIg> M2rxWZJm \ HWlZYOgeIhmKGW6cILld5Nqd25ib3 [gcYlTNTF2NnGgbY4h [SCmb4PlMYRmeGWwZHXueEBu [W6wZYK = MX68ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDh5M {m2OUc, OjR6NkO5OlU9N2F
HeLa NWPKN | ZGTnWwY4Tpc44hSXO | YYm = NEDQbY02yqEQvF2 = мл; 0NlQhcA>? кГц TSodFVVOR NHTCZ3hz \ WS3Y3XzJJRp \ SCjY4Tpeol1gSCxZjDUUmYu | rFicILvcY91 \ XMEoB? = MoTJQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjR4NUe3PFMoRjJ2NkW3O |
A549 Ml7BSpVv [3Srb36gRZN {[Xl? NGLyRYkyOCEQvF2 = MVqx5qCKcA>? MojmbY5pcWKrdIOgeIhmKGmwY4LlZZNmKG: oIIDoc5NxcG9vSd86Ru6yKGmwIGDBNVA {NWmwZnXjeIVlKGO3bIT1doV {yqB? MVq8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDZzMkS4PEc, OjR4MUK2F- 9000
HUVEC NVu4 [2NpTnWwY4Tpc44hSXO | YYm = MnTONlAhyrWP NXTaW2I6OC53IHi = MWTEUXNQ МВт \ wdoV3 \ W62czD0bIUhcW6mdXP0bY9vKG: oIFXBUUBmgHC {ZYPzbY9v Mk \ 4QIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjR3NUGyNFkoRjJ2NUW000: j5
A549RT-eto NHTCc2FCeG: ydH; zbZMhSXO | YYm = NET4WIgyOMLizszN NXHLTII {OjRiaB? = NUPaUVlmTE2VTx? = Mn \ WZYNk \ WyncnH0 [ZMhTkWUTz3t [YRq [XSnZDDhdI9xfG: | aYO = NYnk [ox3RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkS1N | UxQDNpPkK0OVM2OD]
THP-1 MWTGeY5kfGmxbjDBd5NigQ>? M1u1d | AvOS9zwrFOwG0> NW \ mRppFOC53IHi = Mon2ZYJzd2ejdHXzJHRPTi4QsTDz [YNz \ XSrb36gZZMhf2WubDDhd {B1cGViaX7jdoVie2WmIIPlZ5JmfGmxbjDv [kBKVC14IHC1zz5] MXG8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDN5OEWzOkc, OjR | N {i1N-
SKCXCR2 NXr5Vmd5T3Kxd4ToJGlvcGmkaYTpc44hSXO | YYm = NHTETlczKML3TR? = MojmOFghcA>? NI \ Cfo9l \ WO {ZXHz [ZMh [2WubDDwdo9tcW [ncnH0bY9vKHOrZ37p [olk [W62bIm = MUK8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDN5Nke0O {c, OjR | N {[3OFc9N
SKCXCR2 NIW3dm5HfW6ldHnvckBCe3OjeR? = MU [yJOK2VQ>? NFPDZpY1QCCq MVficI9kc3NidHjlJGNZS0xzLXnu [JVk \ WRiY3XscEBqdn [jc3nvci => NGfsbI89 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NEO3Olc1Pyd-MkSzdO:
OVCXCR2 Mn; MSpVv [3Srb36gRZN {[Xl? NF7nPJQzKML3TR? = Mke2OFghcA>? NUDsfZlY [myxY3vzJJRp \ SCFWFPMNU1qdmS3Y3XkJINmdGxiaX72ZZNqd25? M2 \ Ed | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ2M {e2O | Q4Lz5 {NEOz3Olc]
DSC NUfyVXZzTnWwY4Tpc44hSXO | YYm = Мл: 3НК42КМ7: TR? = НХЛNdpkxNjViaB? = NVL3WXVHemW4ZYLz [ZMhfGinIHXubIFv [2WvZX70JI9nKEOFTEKvR2NTOiCneIDy [ZN {cW: wIH; mJGRUS3NiaX7keYNm \ CCkeTDJUE0 {Ow>? MXG8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDN2NEK0NEc, OjR | NESyOFA9N2F
WP MnfTSpVv [3Srb36gRZN {[Xl? Ml7YNlUh | рыП MVq1JI1qdg>? MUDzeZBxemW | c3XzJGFVWCCjbnSgendHKHOnY4LleIlwdg>? NEny [XM9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NEOzNVIxPyd-MkSzd000: LGOD000: LGOD000: LGOD0005:
A549RT-eto MVzBdI9xfG: | aYOgRZN {[Xl? MWCxNOKh | рыП NIi3eoEzPCCq MY \ hZ4NmdGW {YYTld {BHOTRiZYj0doFkfC2vZXTpZZRm \ CCjcH; weI9 {cXNiY3; tZolv \ WRidILlZZRu \ W62IIfpeIghTjF2 MV28ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDJ {MEeyOUc, OjR {MkC3NlU9N2F-
A549RT-eto NFrSV25HfW6ldHnvckBCe3OjeR? = МВтиксНОХ | рыП NGD1e | kzPCCq NWDHN3RL \ GWlcnXhd4V {KHSqZTDlfJBz \ XO | aX; uJIxmfmWuczDv [kBPTi4QulKgZY5lKFBvZ4FCpC => NYPT [ZVQRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkSyNlA4OjVpPkz0Nl3]
FaDu MYHGeY5kfGmxbjDBd5NigQ>? M2n4TlIhcA>? NGrDXFFqdmirYnn0d {BxPjViZYjwdoV {e2mxbjDhcoQh [myxY3vzJHRPTs7zLXnu [JVk \ WRiVGfJV3Qh \ XiycnXzd4lwdg>? M {fyOFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ2MkKwOlIzLz5 {NEKyNFU]
IVD M3 \ XemZ2dmO2aX; uJGF {e2G7 Mk \ INVDDqM7: TR? = НИПиНИУ {КГР? MkHPdoV3 \ XK | ZYOgWG5HNc7z4pETcYVlcWG2ZXSgd5VxeHKnc4Ppc44hd2ZidHjlJIRqe2NibXH0dol5KG2jY4LvcY9t \ WO3bHljs \ WO3bHXzs \ WO3bHJzs \ WO3bHJz \ WO3bHJzs \ WO3bHXz NVTzXVRTRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkSxO | Y5ODhpPkKD6NVc3;
IVD M3XFZ2Z2dmO2aX; uJGF {e2G7 MkLLNVDDqM7: TR? = M {\ 2N | Mh \ A>? MnTRZYJzd2ejdHXzJHRPTi4QsfMAl4lv \ HWlZXSgeZAuemWpdXzheIlwdiCxZjDBSGFOXFNvNDDhcoQhSUSDTWTTMVXDqA>? NYrMeIFERGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkSxO | Y5ODhpPkKBi6PD3;
iNKT M17je2Z2dmO2aX; uJGF {e2G7 M1HDOFExNzFyMDFOwG0> M4jPelAvPSCq M2T0U4lvcGmkaYTzJJRp \ SCrbnT1Z5Rqd25ib3 [gRVJCWiCvUl7BJIFv ​​\ CCxdHjldkBn [WO2b4K = M1niWlxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ2MUK0OFU {Lz5 {NEGyOFQ2]
ПК-3 NVm2 [m9bTnWwY4Tpc44hSXO | YYm = NVnjNVlNOi53L {WvNVAh | ryP M4 \ 5fVAvPSCq NW \ zN3Zw [myxY3vzJGlITi2LST3pcoR2 [2WmIGPUV {BuWk6DIHX4dJJme3Orb39CpC => MmnMQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjRyNUW1NlAoRjJ2MEW1PH?
THP-1 MV \ GeY5kfGmxbjDBd5NigQ>? M3npVFExyqEQvF2 = NUX4R | BCOcLiaB? = MULhZo9tcXOqZYOgeIhmKGWoZnXjeEBw \ iC {SGPQNlchd25iU2KtRUBuWk6D MnS0QIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN7M {mzPVgoRjJ | OUO5000:?
A549 M3XVUmZ2dmO2aX; uJGF {e2G7 МкжРНеХ | рыП MkLjOFghcA>? NVvpRZVR \ W6qYX7j [ZMhfGinIIXwMZJm \ 3WuYYTpc44hd2ZiSd86RkBidmRic4Xid4VyfWWwdDDk [YNz \ WG | ZTDpckBD [YNz \ WG | ZTDpckBD [XhiZYcwmbxvdj2cdjcdjcdjcdjdjdjk2kjkjkjdjcdjdjdjdjkj5jkjkjdjcdjcdjkj5jkjcdjjkjkj5jkjdjdjkj5jkjcdjcdjcdjcdjdjkj5jndjkjdjkjdjkjdjdjkjdjkjdjkj5 NFzSXYU9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {mwNFA5OCd-MkDB3000: L05NFAx5
A549 NXXwVlBzSXCxcITvd4l {KEG | c3H5 M2jDbFHDqM7: TR? = NYeyNIc4PDhiaB? = MWXy [YR2 [2W | IITo [UBk \ WyuIHTlZZRpKGmwZIXj [YQh [nliY3; tZolv \ WRic4TpcZVt [XSrb36 = NEPINnQ9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {mwNFA5OCd-MkO50005NFAxGD +
NCI-N87 MVnHdo94fGhiSX7obYJqfGmxbjDBd5NigQ>? NGLoU5QyOC9 {MD: zNEDPxE1? M135VVYwOjRiaB? = M3XZZpN2eHC {ZYPz [ZMh [2WubDD2bYFjcWyrdImgd4lodmmoaXPhcpRtgQ>? MWG8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzh3NkW0OUc, OjN6NE [1O-FU9N
АГС NF; T [nhIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = NWTzNHJGOTBxMkCvN | Ah | ryP MYO2M | I1KGh? MlHkd5VxeHKnc4Pld {Bk \ WyuII \ pZYJqdGm2eTDzbYdvcW [rY3HueIx6 M1HZdFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | OES2OVQ2Lz5 {M {i0xxOlU1]
MGC80-3 Mln6S5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? NWPj [oFMOTBxMkCvN | Ah | ryP MUW2M | I1KGh? MkfJd5VxeHKnc4Pld {Bk \ WyuII \ pZYJqdGm2eTDzbYdvcW [rY3HueIx6 MlHvQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN6NE [1OFUoRjJ | 9000?
HGC-27 MofKSpVv [3Srb36gRZN {[Xl? MVO3MlUwOTVxM {Cg {txO млHCOkBp NXW2cod5cW6mdXPld {B1cGViZHXwbI9 {eGixconsZZRqd25iYX7kJJVxNXKnZ4XsZZRqd25ib3 [gTe67Ss7z NVPVXG84RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO4OFY2PDVpPkKzPFQ; 9K4h2fHC]
MGC80-3 мм [0SpVv [3Srb36gRZN {[Xl? NVjZTldGPy53L {G1M | MxKM7: TR? = NVOxbYR1PiCq NGnwW3FqdmS3Y3XzJJRp \ SCmZYDoc5NxcG: {eXzheIlwdiCjbnSgeZAuemWpdXzheIlwdiCxZjDJ {tpD | rF? MYK8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzh3NkW0OUc, OjN6NE [1O-
HGC-27 NH \ lWXdCeG: ydH; zbZMhSXO | YYm = NY \ xbIxOPy53L {G1M | MxKM7: TR? = NGfHTI83KGh? MX7pcoR2 [2W | IHHwc5B1d3OrczDpckBiKHSrbXWtJIFv \ CCmb4PlMYRmeGWwZHXueEBu [W6wZYK = MoXFQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN6NE [1OFUoRjJ | 9000 jpc?
HBE NGDwPINHfW6ldHnvckBCe3OjeR? = MorDNVDPxE1? MYqzbC => NHXrZ | di [m: uaYPo [ZMhfGinIHnuZ5Jm [XOnczDv [kBKVC14IHX4dJJme3Orb36gbY5lfWOnZDDifUBEW0V? MkDLQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN6MkSwPFkoRjJg =?
HepG2 M1zZRWZ2dmO2aX; uJGF {e2G7 NWTOdmF3OC5 | L {GvN {DPxE1? NVew [JRWPDhiaB? = NVXnT4sxemWmdXPld {BKVDZvaX7keYNm \ CCST16xJIV5eHKnc4Ppc44> NYPG [HpTRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO3PVE5OzNpPkKzO];
THP-1 NH \ tRXdHfW6ldHnvckBCe3OjeR? = NIXRNHI2KML3TR? = MlSwNUBp Mme1SG1UVw>? MnPDbY5pcWKrdIOgUXRDNWmwZIXj [YQhVkcQulKgZYN1cX [jdHnvci => Mo \ 1QIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN4M {SyNVgoRjJ | NkO0NlE5
THP-1 NIXId | NIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = MkfXOUDDvU1? M {LyRlQwQCCm NFfnXpRFVVOR M2nmWpJm \ HWlZYOgeIhmKH [rYXLpcIl1gSCxZjDpcpRz [WOnbHz1cIFzyqCPVFK = M33FUlxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NkO0NlE5Lz5 {M {9xxYUy6 = M {9xxYUy6] {M {9xxYUy6)
MDM MofYS5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? MX61JOK2VQ>? MmixOE85KGR? NHnQeIRFVVOR M4nmNJJm \ HWlZYOgeIhmKH [rYXLpcIl1gSCxZjDpcpRz [WOnbHz1cIFzyqCPVFK = NGi0S | A9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {[zOFIyQCd-MzOTh2N |
AM NHXsZ2lIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = MlTJOUDDvU1? Ml24OE85KGR? НГ \ ОНГЗФВВОР MkjidoVlfWOnczD0bIUhfmmjYnnsbZR6KG: oIHnueJJi [2WubIXsZZLDqE2WQh? = NXn4U2hHRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO2N | QzOThpP1000]
RAW 264 MmfBSpVv [3Srb36gRZN {[Xl? NGruNpcxNjJvNTFCuW0> NFzJSHI {OC94MD: 5NEBucW5? MX7pcohq [mm2czD0bIUheGixc4DoZZRie2ViYXP0bZZqfHlib3 [gVHRROUMEoB? = NHPiSm89 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {W3PFMxOid-MkO1O1O | g {
HUVEC NFL0XWZHfW6ldHnvckBCe3OjeR? = NVLjS5Y2OTEEoN88US => NF \ NblExNjViaB? = NFP6THdFVVOR Ml6xZ492dnSncnHjeIV {KHSqZTDsc5N {KG: oIGTp [VIhdVKQQR? = MkG4QIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN3NkO2N | IoRjJ | NzU = 9:
HT29 MXLGeY5kfGmxbjDBd5NigQ>? NWnOfGduOTBxM {CvNVAxKM7: TR? = NU \ B [4VROSCq MWfpcohq [mm2ZYOgZo91cCCWV1XBT {1qdmS3Y3XkJJAyODBicILvZ4V {e2mwZx? = NEPsZ449 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {WyO | E2PCd-MkO1NlcyP + 9
HT29 MVfGeY5kfGmxbjDBd5NigQ>? M2LDXVExNzNyL {GwNEDPxE1? NH; yTIEyKGh? MY \ pcohq [mm2czDUUmYucW6mdXPl [EBxcG: | cHjvdplt [XSrb36gZY5lKGSnZ4Lh [IF1cW: wIH; mJGnPwkMQsR? = MnXQQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN3MkexOVQoRjJ | NUK3NVU]
ММ.1С NHGyTIdCeG: ydH; zbZMhSXO | YYm = МВузНЕДДвУ1? MmXRN {Bp NGL2WGNqdmS3Y3XzJG1OKGOnbHyg [IVifGhiaX72c4x3 \ XNibnXjdo9 {cXN? M2W4U | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NUK3NVU1Lz5 | E6 = 9
КМС-12-БМ NYPVfYFoSXCxcITvd4l {KEG | c3H5 NXPZd2tKOzBiwsXN MUWzJIg> NWDseWd2cW6mdXPld {BOVSClZXzsJIRm [XSqIHnueo9tfmW | IH7lZ5Jwe2m | MmrNQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN3MkexOVQoRjJ | NUK3NVU]
БАФ M1jvRWZ2dmO2aX; uJGF {e2G7 MYqwMlUwOcLizszN MoLHNlQhcA>? NI \ FXWdqdmirYnn0d {BVVkcQsT; ESXghcW6mdXPl [EBEYVBzOVGxxsB1emGwc3PybZB1ew>? MnLRQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN2OEW0OVcoRjJ | NEi1OFU4RC:
SP6.5 MXPGeY5kfGmxbjDBd5NigQ>? NIfQOnU2KM7: TR? = NVftVoxLOiCq M2fmO4Rm [3KnYYPld: KhfHKjboPsc4NifGmxbjDv [kBxPjViaX6geIhmKG63Y3zleZPDqA>? NWC3fnZERGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO0OFMxQDZp000]
ВУП MVjGeY5kfGmxbjDBd5NigQ>? NWfFNVJKPSEQvF2 = MUKyJIg> Mn3i [IVkemWjc3XzxsB1emGwc3zvZ4F1cW: wIH; mJJA3PSCrbjD0bIUhdnWlbHX1d: Kh MVS8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzR2M {C4Okc, OjN2NEOwPFY9000
OCM1 M3TXNWZ2dmO2aX; uJGF {e2G7 MlHhOUDPxE1? NHXqS3gzKGh? M3jqcIRm [3KnYYPld: KhfHKjboPsc4NifGmxbjDv [kBxPjViaX6geIhmKG63Y3zleZPDqA>? M37CdFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NESzNFg3Lz5 {MP = 9xxYU6 |
OM431 NWewcJE3TnWwY4Tpc44hSXO | YYm = NUToe4tQPSEQvF2 = Нью-Йорк \ lZmhsOiCq M37NcoRm [3KnYYPld: KhfHKjboPsc4NifGmxbjDv [kBxPjViaX6geIhmKG63Y3zleZPDqA>? M3fne | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NESzNFg3Lz5 {MP = 9xxYU6]
SP6.5 MlLhS5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? NGjOWnEzNjVvMkCg {txO MUKyOEBpyqB? NHHMTW1KSzVyPUWg {txONCCneHjpZol1eyC | dILvcoch [W62aT3wdo9tcW [ncnH0bZZmKGWoZnXjeJMhcW5iYTDkc5NmNWSncHXuX [IVvfCCv MV: 8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzR2M {C4Okc, OjN2NEOwPFY9000
ВУП Ml3VS5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? NHXiN40zNjVvMkCg {txO NWG2eFdMOjRiaNMg NHLyVIVKSzVyPUWg {txONCCneHjpZol1eyC | dILvcoch [W62aT3wdo9tcW [ncnH0bZZmKGWoZnXjeJMhcW5iYTDkc5NmNWSncHXu [4 NYHnOFQxRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO0OFMxQDZp000;
OCM1 NV3tbmNkT3Kxd4ToJGlvcGmkaYTpc44hSXO | YYm = M1 \ PT | IvPS1 {MDFOwG0> NHTrc | QzPCCqwrC = NWj0eWJ {UUN3ME21JO69VSxiZYjobYJqfHNic4Tyc45oKGGwdHmtdJJwdGmoZYLheIl3 \ SCnZn \ lZ5R {KGmwIHGg [I9 {\ S2mZYDlcoRmdn NUHxW5lXRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO0OFMxQDZp9]
OM431 NHXESmtIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = M4LVSFIvPS1 {MDFOwG0> M1fxblI1KGkEoB? = Mn71TWM2OD13IN88UUwh \ XiqaXLpeJMhe3S {b37nJIFvfGlvcILvcIln \ XKjdHn2 [UBm \ m [nY4TzJIlvKGFiZH; z [U1l \ XCnbnTlcpQnhdy MWC8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzR2M {C4Okc, OjN2NEOwPFY
SP6.5 NGOyU3VCeG: ydH; zbZMhSXO | YYm = M4nXN | Uh | ryP NH: 2VJAzPCCqwrC = NYXCfZJvcW6mdXPld {BieG: ydH; zbZPDqA>? MVi8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzR2M {C4Okc, OjN2NEOwPFY9000
ВУП NYXCcXh4SXCxcITvd4l {KEG | c3H5 M3TaSlUh | РыП MY [yOEBpyqB? MkDzbY5lfWOnczDhdI9xfG: | aYRCpC => NEL2OmU9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {S0N | A5Pid-MkGD + 9OFM
OCM1 M1 \ J [2Fxd3C2b4Ppd {BCe3OjeR? = NWDKd4lCPSEQvF2 = NEmyWVczPCCqwrC = MnXEbY5lfWOnczDhdI9xfG: | aYRCpC => NEfScJA9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {S0N | A5Pid-MkO0000: L1
OM431 MVjBdI9xfG: | aYOgRZN {[Xl? M1PUclUh | рыП NXHJ [o5EOjRiaNMg NYjXNY4xcW6mdXPld {BieG: ydH; zbZPDqA>? NETIUpc9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {S0N | A5Pid-MkO00005: L0N |
SP6.5 MVzGeY5kfGmxbjDBd5NigQ>? NXf3PZJ3PSEQvF2 = NXfXd | dFOTJiaB? = MnT4doVlfWOnczD0bIUhdWmpcnH0bY9vyqB? MlXRQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN2NEOwPFYoRjJ3 =?
ВУП NWHrOmx4TnWwY4Tpc44hSXO | YYm = NYnsXZU5PSEQvF2 = MYKxNkBp NWLRO3A1emWmdXPld {B1cGVibXnndoF1cW: wwrC = NGjMXpI9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {S0N | A5Pid-MkGO0OF:
OCM1 M2nVeGZ2dmO2aX; uJGF {e2G7 NVT4Toh6PSEQvF2 = NXvkNGpROTJiaB? = NHi5To9z \ WS3Y3XzJJRp \ SCvaXfyZZRqd28EoB? = M1zaelxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NESzNFg3Lz5 {M {Sj0N | A5
OM431 M37Jb2Z2dmO2aX; uJGF {e2G7 NYroZmM5PSEQvF2 = NXq4WJk3OTJiaB? = NHjMXlRz \ WS3Y3XzJJRp \ SCvaXfyZZRqd28EoB? = NWPFSmhuRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO0OFMxQDZpPk5DiPQ;
HBL-1 NGDHdHRIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = NWf1dJk1O8LizszN MoXLNlQwPDhxN {KgbC => Mn \ USG1UVw>? NFzPXoV {dG: 5czDj [YxtKGe {b4f0bEBud2Snc4TsfS => NIXnVlM9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {S0NVGc {OCd-MzO5O5]
RAW 264.7 MYfGeY5kfGmxbjDBd5NigQ>? МВггМВЕ2КМ7: TR? = NVPhOolnOSCq NIX6WXhFVVOR NYfo [WZGe3WycILld5NmeyC2aHWgZYN1cX [jdHnvckBw \ iCLS1ug [oFucWy7Ih4lcYJmenN? M1rqe | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NESxO | MxLz5c {M {S0NVU6]
Ил-1Р NXXP [pU3TnWwY4Tpc44hSXO | YYm = M {DwXFIuOTVizszN M17weFEhcA>? M13qXmROW09? MYLzeZBxemW | c3XzJJRp \ SCjY4TpeoF1cW: wIH; mJGlMUyCoYX3pcJkhdWWvYnXydy => MkXOQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN2NEG3N | AoRjJ | NESxOPh | NESxOPh |
RAW 264.7 NE \ xfmVHfW6ldHnvckBCe3OjeR? = МнфыНВУх | рыП NWTEbmNrOSCq NYTzWoNsTE2VTx? = M1 \ zVZN2eHC {ZYPz [ZMhfGinIHHjeIl3 [XSrb36gc4Yh [W6mIFrOTy => NXPwZox1RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkO0OFE4OzBpPkKzOFQ]
Ил-1Р NV7nXGk6TnWwY4Tpc44hSXO | YYm = MXKxOUDPxE1? NGHxS3oyKGh? NWLGSnlJTE2VTx? = MY \ zeZBxemW | c3XzJJRp \ SCjY4TpeoF1cW: wIH; mJIFv \ CCMTlu = MmXKQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN2NEG3N | AoRjJ | NESxOPh |
U2OS NF7ROXpHfW6ldHnvckBCe3OjeR? = NHSydJgyPSEQvF2 = Mn7MNUBp M {fTb2ROW09? NHf6ZpdxemW4ZX70d {B1cGViTGDTMUBweiCLTD2xMZN1cW23bHH0 [YQh \ m: {bXH0bY9vKG: oIFu2N {1xXWJiY3jhbY5 {yqB? M3nJV | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | NESxO | MxLz5c {M {S0NVU6]
МТ ‐ 1 MWPGeY5kfGmxbjDBd5NigQ>? NXPFdI1NQMLiwsXt MoXJN {Bp MkHv [IVkemWjc3XzJJRp \ SCuZY \ lcJMhd2ZicPMAlHNVSVR | IHHu [EBx6oDSNFXCVFE> MlHPQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjN {N {i0O | koRjJc | 9000]
МТ ‐ 2 NFzsN2xHfW6ldHnvckBCe3OjeR? = MYq4xsDDvW1? M1jDOlMhcA>? NUXGXZFJ \ GWlcnXhd4V {KHSqZTDs [ZZmdHNib3 [gdQKBmFOWQWSzJIFv \ CCy4pEQOGVDWDF? M4 \ uTFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | Mke4OFc6Lz5 {M4 = 9T3PFQ5 {M4 =
МТ ‐ 1 MVLGeY5kfGmxbjDBd5NigQ>? NGjKblE5yqEEtX2 = NWSxelViOyCq MYXk [YNz \ WG | ZYOgeIhmKGyndnXsd {Bw \ iC2aHWgdFY2KHO3YoXubZQhd2ZiTldihLDPwkMEoB? = M {XKXlxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | Mke4OFc6Lz5 {M4 = 9TXXYQU6]
МТ ‐ 2 MkTaSpVv [3Srb36gRZN {[Xl? M1zxT | jDqML3bR? = M4jQSFMhcA>? NInPNIdl \ WO {ZXHz [ZMhfGinIHzleoVteyCxZjD0bIUheDZ3IIP1ZpVvcXRib3 [gUmbjiJEQulNCpC => NIK0fVM9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {K3PFQ4QSd-MkOyO: g
MCF-7 NYnVWXpOTnWwY4Tpc44hSXO | YYm = MlTCNk42NTF3IN88US => M3fpdVAvPSCq MVnEUXNQ M1LP [4NifXOnczD0bIUh \ 3KjZIXhcEBtd3O | IH; mJINmdGxiYXTo [ZNqd25? NH; qWG49 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {M {C5N | IzPyd-MkOjd000: L1PVMz
HaCaT M1; qcGZ2dmO2aX; uJGF {e2G7 MXu1MlDDqM7: TR? = M4LwZVHDqGkEoB? = MUHheJRmdnWjdHXzJJRp \ SCWQ1; IMYlv \ HWlZXSgdJJw \ HWldHnvckBw \ iCLTD22xsA> MVK8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzB2MUG2PEc, OjNyNEGxOlg9N
A549 NF70SFhHfW6ldHnvckBCe3OjeR? = мм XtNUBp MlPnbY5pcWKrdIOgUHRCNWmwZIXj [YQhW1BvQTDtVm5CKHC {b3T1Z5Rqd28EoIPp [45q \ mmlYX70cJk> MYO8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOzB | MUKxN {c, OjNyM {GyNVM9000]
Хондроциты ОА MoXLSpVv [3Srb36gRZN {[Xl? МхМНВАх | рыП MUWxJIg> MWficI9kc3NidHjlJGFITS2EU1GtbY5lfWOnZDDn [Y5mN3C {b4TlbY4h \ XiycnXzd4lwdiCxZjDHVnA4QCCxcjDDU3guOiBqc2Ml>? M2W5NFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ {OUiyNlI5Lz5 {Mkm4NlIU]
RAW264.7 M2PJWWZ2dmO2aX; uJGF {e2G7 MUCxOUDPxE1? MXmxOU0yOjBibXnu MXzicI9kc3NidHjlJJBzd2S3Y4Tpc44hd2ZiTl: sJHBITTJuIHHu [EBVVkZvzsG = NXHZOZk4RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkK3OFU2OjNp9000] |
RAW264.7 Mn3US5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? MlfPOU0 {OCEQvF2 = NUP0SVVCOjRiaB? = NXTiVHREcW6qaXLpeJMh [2WubDDndo94fGhiaX6gZUBld3OnLXTldIVv \ GWwdDDtZY5v \ XJ? NGXLWpk9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {Mke0OVUzOyd-MkKj3OFU5:
HBL6 MXzBdI9xfG: | aYOgRZN {[Xl? M1XhOFAvPS93L {K1JO69VQ>? NVzMN | RwPi9 {NDDo NV; kc | Ju \ GWlcnXhd4V {KGOnbHygeoli [mmuaYT5JIFv \ CCuZXXh [JMhfG9iYYDvdJRwe2m | IHnuJIEh \ G: | ZT3k [ZBmdmSnboSgcYFvdm = 9000] NVXtbm02RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkKwO | Q5OjBpPkDyNF]
HT29 NYW0b2NOTnWwY4Tpc44hSXO | YYm = M1LuXFEuOTBizszN M2fVd | ExyqCq MWPpcoNz \ WG | ZYOgTG8uOSCvUl7BJIFv ​​\ CCycn; 0 [YlvKGW6cILld5Nqd25? M1fVfFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJzNkKwPVY1Lz5 {MU = 9D
Ca9–22 NE \ yZ49CeG: ydH; zbZMhSXO | YYm = M1XxVFExyqEQvF5CpC => МВ [xJIg> MYDjc41xdGW2ZXz5JIlvcGmkaYTzJGFNSS2SRGStbY5lfWOnZDDhdI9xfG: | aYO = NF2zSJg9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {MUGzPFQ5OCd-MkGD000: g
Ca9–22 MnTwSpVv [3Srb36gRZN {[Xl? NWPv [GREOTEEoN88UeKh MUCxJIg> MUfjc41xdGW2ZXz5JIFjem: pYYTld {B1cGViQVzBMXBFXC2rbnT1Z4VlKEqQSzDhZ5RqfmG2aX; u MYO8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zOTF | OES4NEc, OjFzM {i0PFA9N2F
A-549 NG \ sb5pIem: 5dHigTY5pcWKrdHnvckBCe3OjeR? = NX3EeWVFOTEEoN88UeKh MX: yOE81QCCq M {jNfYlvcGmkaYTzJINmdGxiZ4Lve5RpKGmwIHGgeIlu \ S2mZYDlcoRmdnRibXHucoVz MXG8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zODh5NkC0N {c, OjB6Nk [wO-
AP MX; GeY5kfGmxbjDBd5NigQ>? NW \ NZ2t7PS9zMDFOwG0> NYrKPI1HPDhiaB? = MXfkc5dvemWpdXzheIV {KHSqZTDCRWQheHKxdHXpckBt \ X [nbDDhJIRwe2VvZHXw [Y5l \ W62Ih4hco5meg>? NI \ 0NG49 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {MEW5OlY1PSd-MkC1PVY3PD-MkC1PVY3G
AQ1 NILHXWlHfW6ldHnvckBCe3OjeR? = ммTrOU8yOCEQvF2 = M1WxfFQ5KGh? Mmix [I94dnKnZ4XsZZRmeyC2aHWgRmFFKHC {b4TlbY4hdGW4ZXygZUBld3OnLXTldIVv \ GWwdDDtZY5v \ XJ? NXrocHpqRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkC1PVY3PDVpPk5KwOVk>
AP NVK5XXhYTnWwY4Tpc44hSXO | YYm = M2DyblIxKM7: TR? = NGS2Uoo1NzhiaB? = M3G5O4Rwf26 {ZXf1cIF1 \ XNidHjlJGJCTCCycn; 0 [YlvKGyndnXsJIEhfGmvZT3k [ZBmdmSnboSgcYFvdmW { MmHwQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjB3OU [2OFUoRjJyNUm =?
AQ1 NEjI [JdHfW6ldHnvckBCe3OjeR? = NVvFU4o1OjBizszN MVO0M | ghcA>? M4 \ XZoRwf26 {ZXf1cIF1 \ XNidHjlJGJCTCCycn; 0 [YlvKGyndnXsJIEhfGmvZT3k [ZBmdmSnboSgcYFvdmW { NV; UemRKRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkC1PVY3PDVpPkjKwOVk3; 9K4h2fHC]
THP-1 NE \ hOW1HfW6ldHnvckBCe3OjeR? = M4 \ XcFXDqM7: TdMg M3rF [| AvPSCq NF \ jcmRifHSnboXheIV {KHSqZTDMVHMucW6mdXPl [EBxNUoQulNOtUBxem: 2ZXnuJIJ6KDd {JR? = MmHLQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjB | MEm3NVgoRjJyM {C5000 | E?
K562 NV \ HVYN5T3Kxd4ToJGlvcGmkaYTpc44hSXO | YYm = MXuyMVMxKM7: TR? = MmfXNlQhcA>? MY \ JR | UxRThizszNMIlvcGmkaYTzJINmdGxiZ4Lve5RpKGmwIHGg [I9 {\ S2mZYDlcoRmdnRibXHucoVz M3u2S | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzF7NkS2PFA4Lz5zOU [0OlgUz6]
Jurket мл; aS5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? NV \ hPFNtOi1 | MDFOwG0> Mly5NlQhcA>? NGjsZVZKSzVyPUeuNUDPxE1uIHnubIljcXS | IHPlcIwh \ 3Kxd4ToJIlvKGFiZH; z [U1l \ XCnbnTlcpQhdWGwbnXy MonJQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOTl4NE [4NFcoRjF7NkS2PFA4RC: 9
U937 MnPQS5Jwf3SqIFnubIljcXSrb36gRZN {[Xl? M3ntSVIuOzBizszN MX: yOEBp MVfJR | UxRTFyLkWg {txONCCrbnjpZol1eyClZXzsJIdzd3e2aDDpckBiKGSxc3Wt [IVx \ W6mZX70JI1idm6nch? = M3niN | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzF7NkS2PFA4Lz5zOU [0OlgU6]
PBMC M1vnbGdzd3e2aDDJcohq [mm2aX; uJGF {e2G7 NHvLU2UzNTNyIN88US => NULwXGM1OjRiaB? = NFf3c2tKSzVyPUSwMlIh | ryPLDDpcohq [mm2czDj [YxtKGe {b4f0bEBqdiCjIHTvd4Uu \ GWyZX7k [Y51KG2jbn7ldi => MYO8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8yQTZ2NkiwO {c, OTl4NE [4NFc9NE]
K562 NIPyb41CeG: ydH; zbZMhSXO | YYm = MXqyMVIxyqEQvF5CpC => MnfjNlQhcA>? MoLjbY5lfWOnczDhJIRwe2VvZHXw [Y5l \ W62IHHwc5B1d3Orcx? = NH7rW5Y9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9zOU [0OlgxPyd-MUm2OFY]
THP1 M {C5SGN6fG: 2b4jpZ4l1gSCjc4PhfS => M1rne | czKGi {cx? = MmrjR5l1d3SxeHnjbZR6KGGpYXnud5QhcHWvYX6gWGhROSClZXzsd {Bie3Onc4Pl [EBieyC {ZXT1Z5Rqd25iaX6gZ4VtdCC4aXHibYxqfHliYX \ 0 [ZIhPzJiaILzJIJ6KE2WVDDhd5NigSxiVFO1NEA: KDFwNTFOwG0v NV2ydnB3RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMki0NVA1PDJpPki {> 9OF;
RAW264.7 M3; vd2Z2dmO2aX; uJIF {e2G7 NFLiO3Q3KGi {cx? = NXvab2Z {UW6qaXLpeIlwdiCxZjDMVHMucW6mdXPl [EBPTi2tYYDwZWIh [WO2aY \ heIlwdiCrbjDtc5V {\ SCUQWeyOlQvPyClZXzsd {B1emWjdHXkJFMxKG2rboOgZoVnd3KnIFzQV {BkcGGubHXu [4UhdWWjc4Xy [YQh [Вт [2ZYKgOkBpenNiYomgcJVkcW [ncnHz [UBZ \ XCxcoTldkBo \ W6nIHHzd4F6NCCLQ {WwJF0hOS55MjFOwG0v NYnxcIpiRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkSzNVUyQTFpPkOTLiN> 9K4h2fHC | E
HEK293 NEfXTIdHfW6ldHnvckBie3OjeR? = NV3sZoczPiCqcoO = NYXpOVhjUW6qaXLpeIlwdiCxZjDUUmYu [WyyaHGtbY5lfWOnZDDOSk1s [XCyYVKgZYN1cX [rdImgbY4hUEWNMkmzJINmdGy | IHHmeIVzKDZiaILzJIJ6KGy3Y3nm [ZJie2VicnXwc5J1 \ XJiZ3Xu [UBie3OjeTygTWM2OCB; IEKg {txONg>? NYXuOItnRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkS1N | M5PTdpPkDK0OVM> {hQ5OVM>
HEK293 MV \ GeY5kfGmxbjDhd5NigQ>? мм \ МОкБпенН? MYrJcohq [mm2aX; uJI9nKFSQRj3hcJBp [S2rbnT1Z4VlKE6ILXvhdJBiSiCjY4Tpeol1gSCrbjDISWszQTNiY3XscJMh [Вт [2ZYKgOkBpenNiYomgcJVkcW [ncnHz [UBZ \ XCxcoTldkBo \ W6nIHHzd4F6NCCLQ {WwJF0hOiEQvF2u NHfGV | k9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NEm5NlcxOid-MkS5PVI4
HEK293 MVrGeY5kfGmxbjDhd5NigQ>? MoL6OkBpenN? MkLUTY5pcWKrdHnvckBw \ iCWTl \ hcJBp [S2rbnT1Z4VlKE6ILXvhdJBiSiCjY4Tpeol1gSBqdX7rco94diCxcnnnbY4qKHS {YX7z [oVkfGWmIHnuJGhGUzJ7MzDj [YxteyCjZoTldkA3KGi {czDifUBtfWOrZnXyZZNmKHKncH; yeIVzKGenbnWgZZN {[XluIFnDOVAhRSB {IN88UU4> MkjmQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjZ | NEO4NlgoRjJ4M {SzPh?
HEK293 NEfzcIpHfW6ldHnvckBie3OjeR? = NYrUbJl3PiCqcoO = NFXjRXVKdmirYnn0bY9vKG: oIGTOSoFteGijLXnu [Дж.В.К. \ WRiTl [tb4FxeGGEIHHjeIl3cXS7IHX4dJJme3OnZDDpckBpfW2jbjDISWshOjl | IHPlcIx {KGGodHXyJFYhcHK | IHL5JIx2 [2moZYLhd4UhemWyb4L0 [ZIH \ 2WwZTDhd5NigSxiSVO1NEA: KDJizszNMi => M {C1dFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ {OEWwNlA4Lz5 {Mki1NFIxP
HEK293 МВт \ GeY5kfGmxbjDhd5NigQ>? NYnvOY5zPiCqcoO = MY \ Jcohq [mm2aX; uJI9nKFSQRnHsdIhiNWmwZIXj [YQhcHWvYX6gUmZs [XCyYVKgZYN1cX [rdImgbY4hUEWNMkmzJINmdGy | IHnuZ5Vj [XSnZDDmc5IhPiCqcoOg [o9tdG: 5ZXSgZpkh [2: Vch; 1coQhf2G | aDDveZQhdWWjc4Xy [YQh [W [2ZYKgOUBucW6 | IHL5JIJ6KGy3Y3nm [ZJie2ViYYPzZZktKEmFNUCgQUAzNjBzIN88UU4> NHPLSJQ9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {MkexNlQ {Oid-Mkz3000: LVI1O
HEK293 NWG2S2trS3m2b4TvfIlkcXS7IHHzd4F6 MkfGR5l1d3SxeHnjbZR6KGGpYXnud5QhUEWNMkmzJINmdGy | LDDJR | UxKD1iMz64JO69VS5? MXG8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDV | M {i1O {c, OjR3M {O4-0005N]
HEK293 NGD6b4RHfW6ldHnvckBie3OjeR? = MlfGOkBpenN? М {P4UGlvcGmkaYTpc44hd2ZiVF7GZYxxcGFvaX7keYNm \ CCQRnvhdJBiSiBqdX7rco94diCxcnnnbY4qKGGldHn2ZZRqd25iZYjwdoV {e2WmIHnuJGhGUzJ7MzDj [YxteyCjZoTldkA3KGi {czDifUBtfWOrZnXyZZNmKHKncH; yeIVzKGenbnWgZZN {[XluIFnDOVAhRSB3IN88UU4> M2XwU | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ | M {G2PVUxLz5 {M]
HEK293 MWnGeY5kfGmxbjDhd5NigQ>? NIrxephG \ м [nY4Sgc44hS2SlMjDlfJBz \ XO | ZXSgbY4hUEWNMkmzJINmdGy | IHHzd4V {e2WmIHHzJIVn \ mWldDDvckBE \ GN {OlPkZ | I2SyCrboTldoFkfGmxbjDjc41xdGW6ZYOgbY4heHKnc3XuZ4Uhd2ZiY3HtdJRwfGinY3nuJIJ6KEW \ RmCgZY5lN2: {IGnGVEBX \ W63czDmdoFodWWwdDDiZZNm \ CC {ZYDvdpRmeiCpZX7lJIF {e2G7 M37oU | xiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzF4NkiwNVU6Lz5zNk [4NFE6
HEK293 NFTGdGhHfW6ldHnvckBie3OjeR? = NEK4WW4zOCC3TR? = NX72ZpZEOjRiaILz MlW0TY5pcWKrdHnvckBw \ iCWTl [tZYxxcGFic4TpcZVt [XSnZDDOSotieHCjQjD0doFve2GldHn2ZZRqd25iaX6gTGVMOjl | IHPlcIx {KGG2IEKwJJVOKG2nYYP1doVlKGGodHXyJFI1KGi {czDifUBlfWGuIHz1Z4ln \ XKjc3WgdoVxd3K2ZYKg [4Vv \ SCjc4PhfS => MUe8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPzd | NkC2N {c, Ojd50005M {[wOlM9]
RAW264.7 MkPXSpVv [3Srb36gZZN {[Xl? NIDHTJkzOCC3TR? = M1; H [lEhcHJ? MUnJcohq [mm2aX; uJI9nKEySUz3pcoR2 [2WmIF7Gb2Ih [WO2aY \ heIlwdiCrbjDtc5V {\ SCUQWeyOlQvPyClZXzsd {Bie3Onc4Pl [EBieyC {ZXT1Z5Rqd25iaX6gcpVkdGWjcjD0doFve2yxY3H0bY9vKG: oIIC2OUBifCB {MDD1UUBxemWrbnP1ZoF1 \ WRiZn; yJFEhcHJiZn; scI94 \ WRiYomgUHBUKHO2aX31cIF1cW: wIh4lZZN2emWmIHHmeIVzKDNiaILzJIJ6KFenc4Tldo4h [myxdDDt [ZRpd2R? NVjBclJxRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMki2Olc5PzNpPkKDiOlY4;
RAW264.7 NHHPXIdHfW6ldHnvckBie3OjeR? = M4q0TVIxKHWP MUm2JIhzew>? MVTJcohq [mm2aX; uJI9nKEySUz3pcoR2 [2WmIF7GMYtieHCjQjDhZ5RqfmG2aX; uJIlvKG2xdYPlJHJCXzJ4ND63JINmdGy | IHH0JFIxKHWPIITy [Yf1 \ WRIM {CgcYlveyCkZX \ vdoUhVFCVIHPoZYxt \ W6pZTDt [YF {fXKnZDDh [pRmeiB4IHjyd {BjgSCudXPp [OVZ [XOnIILldI9zfGW {IHflcoUh [XO | YYm = M3jNblxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ2M {G1NVkyLz5 {NEOYxOVE6OT]
RAW264.7 мл; VRY51cW6obHHtcYF1d3K7IHHzd4F6 M37wdlIxKHWP MlS1NVghcHK | М.В., BcpRqdm [uYX3tZZRwenliYXP0bZZqfHliaX6gcY92e2ViUlHXNlY1NjdiY3XscJMh [XO | ZYPz [YQh [XNiaX7obYJqfGmxbjDv [kBNWFNvaX7keYNm \ CCwaYTybYMhd3irZHWgdJJw \ HWldHnvckBifCB {MDD1UUB1emWjdHXkJFMxKG2rboOgZoVnd3KnIFzQV {BkcGGubHXu [4UhdWWjc4Xy [YQh [W [2ZYKgNVghcHK | IHL5JGdzcWW | czDhd5NigQ>? NEmxc3M9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NEOxOVE6OSd-MkSzNVUyQT]
THP1 M2KxeGFvfGmwZnzhcY1ifG: {eTDhd5NigQ>? МВ: 1JJVO MVqyOEBpenN? NFPJ [nFCdnSraX7mcIFudWG2b4L5JIFkfGm4aYT5JIlvKGi3bXHuJHRJWDFiY3XscJMh [XO | ZYPz [YQh [XNiaX7obYJqfGmxbjDv [kBVWEFxaX; uc416 [2mwLXnu [Дж.В.К. \ WRiZYj0doFk \ WyudXzhdkBKVC1zYnX0ZUBt \ X [nbDDheEA2KHWPIHnuZ5Vj [XSnZDCxJIhzKHC {аХ; yJJRwKFSSQT; pc45wdXmlaX6gZ4hidGynbnflJI1m [XO3cnXkJIFnfGW {IEK0JIhzeyCkeTDFUGlUSQ>? NWDEZ4RoRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkS0NFA5PThpPkKViFAx;
THP1 NFLKbYtCdnSrbn \ sZY1u [XSxcomgZZN {[Xl? NXLQb | lNPSC3TR? = NUGzRpl3OjRiaILz NWC4fWRUSW62aXnu [oxidW2jdH; yfUBi [3Srdnn0fUBqdiCqdX3hckBVUFBzIHPlcIx {KGG | c3Xzd4VlKGG | IHnubIljcXSrb36gc4YhXFCDL3nvco9ugWOrbj3pcoR2 [2WmIHX4eJJi [2WubIXsZZIhXE6ILXHsdIhiKHC {b3T1Z5Rqd25iYYSgOUB2VSCrbnP1ZoF1 \ WRiMTDodkBxemmxcjD0c {BVWEFxaX; uc416 [2mwIHPoZYxt \ W6pZTDt [YF {fXKnZDDh [pRmeiB {NDDodpMh [nliRVzJV2E> NFrNW4M9 [SC2YYLn [ZQ: L1: kbHHub {chcHKnZk2nbJR1eHN8Lz; weYJu \ WRwbnPibU5vdG1wbnnoModwfi9 {NESwNFg2QCd-MkS0NFA3
THP1 NIr2fmpCdnSrbn \ sZY1u [XSxcomgZZN {[Xl? MV61JJVO MnjINlQhcHK | MnzURY51cWmwZnzhcY1ifG: {{eTDhZ5Rqfmm2eTDpckBpfW2jbjDUTHAyKGOnbHzzJIF e2W | c3XkJIF {KGmwaHnibZRqd25ib3 [gWHBCN2mxbn; tfYNqdi2rbnT1Z4VlKGmwdILhZ4VtdHWuYYKgdJJwUUxvMXLleIEhdGW4ZXygZZQhPSC3TTDpcoN2 [mG2ZXSgNUBpeiCycnnvdkB1dyCWUFGvbY9vd227Y3nuJINp [WyuZX7n [UBU \ РГ | dYLl [EBI \ nSncjCyOEBpenNiYomgSWxKW0F? MoXMQIEhfGG {Z3X0QUdg [myjbnunJIhz \ WZ; J3j0eJB {Qi9xcIXicYVlNm6lYnmucoxuNm6raD7nc5YwOjR2MEC4OVgoRjJ2NECwPFU5RC: 9
THP1 M2P3R2FvfGmwZnzhcY1ifG: {eTDhd5NigQ>? M4TIOFUhfU1? NFnLWnAzPCCqcoO = NHjmSmdCdnSraX7mcIFudWG2b4L5JIFkfGm4aYT5JIlvKGi3bXHuJHRJWDFiY3XscJMh [XO | ZYPz [YQh [XNiaX7obYJqfGmxbjDv [kBVWEFxaX; uc416 [2mwLXnu [Дж.В.К. \ WRiaX70doFk \ WyudXzhdkBKVC1zYnX0ZUBt \ X [nbDDheEA2KHWPIHnuZ5Vj [XSnZDCxJIhzKHC {аХ; yJJRwKFSSQT; pc45wdXmlaX6gZ4hidGynbnflJI1m [XO3cnXkJIFnfGW {IEK0JIhzeyCkeTDFUGlUSQ>? MYO8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPDRyMEi1PEc, OjR2MEC4OVg9N2F
RAW264.7 MVrGeY5kfGmxbjDhd5NigQ>? M1uyVlAvOyC3Zz; tcC => MXKxNkBpenN? NFPsdnVKdmirYnn0bY9vKG: oIFzQV {1qdmS3Y3XkJG5HNWuEIIC2OUBxcG: | cHjvdplt [XSrb36gbY4hdW: 3c3WgVmFYOjZ2LkegZ4VtdHNiYYSgNE4 {KHWpL33sJJBz \ WmwY4XiZZRm \ CCob4KgNVIhcHK | IH \ vcIxwf2WmIHL5JGxRWyC | dHnteYxifGmxbjDmc5IhOyCqcoOgZpkhX2W | dHXyckBjdG: 2Ih4leIhw \ A>? M1: 2OFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ6Mki0PFA3Lz5 {OEK4000YUg
RAW264.7 NFy0VnhHfW6ldHnvckBie3OjeR? = NWh4U4lXOC5 | IIXnM41t NXTU [JZDOTJiaILz MmDqTY5pcWKrdHnvckBw \ iCOUGOtbY5lfWOnZDDOSk1sSiCyNkWgZYN1cX [jdHnvckBqdiCvb4Xz [UBTSVd {NkSuO {Bk \ WyuczDheEAxNjNidXevcYwheHKnaX7jeYJifGWmIH \ vdkAyOiCqcoOg [o9tdG: 5ZXSgZpkhVFCVIIP0bY12dGG2aX; uJIZweiB | IHjyd {BjgSCGQWDJJJN1 [WmwaX7nJIJie2WmIHnueoVzfGWmIH \ seY9z \ XOlZX7j [UBucWO {b4Pjc5Bq [yCvZYToc4Q> NVnl [GZuRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkiyPFQ5ODZpPkKD4Nlg1;
RAW264.7 MYDGeY5kfGmxbjDhd5NigQ>? NI \ ZdWcxNjNidXevcYw> NF; Zd5EyOiCqcoO = MUfJcohq [mm2aX; uJI9nKE6ILXvCJJA3PSCrbjDtc5V {\ SCUQWeyOlQvPyClZXzsd {Bie3Onc4Pl [EBieyC {ZXT1Z5Rqd25iaX6gUHBUNWmwZIXj [YQhcU6RUzDlfJBz \ XO | аХ; uJIF1KDBwMzD1 [{9udCCycnXpcoN2 [mG2ZXSg [o9zKDF {IHjyd {Bnd2yub4fl [EBjgSCOUGOgd5RqdXWuYYTpc44h \ м: {IEOgbJJ {KGK7IGfld5Rmem5iYnzveEBu \ XSqb3S = МВ [8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zQDJ6NEiwOkc, Ojh2 {OES4NFY9N]
RAW264.7 M3zIW2Z2dmO2aX; uJIF {e2G7 NWi3SoVPOC5 | IIXnM41t MVyxNkBpenN? М {PVZWlvcGmkaYTpc44hd2ZiTl [tb2IheDZ3IHnuJI1wfXOnIGLBW | I3PC55IHPlcIx {KGG | c3Xzd4VlKGG | IILl [JVkfGmxbjDpckBNWFNvaX7keYNm \ CCFT2iyJIV5eHKnc4Ppc44h [XRiMD6zJJVoN22uIIDy [YLV [3WkYYTl [EBnd3JiMUKgbJJ {Кг [xbHzve4VlKGK7IFzQV {B {fGmvdXzheIlwdiCob4KgN {BpenNiYomgW4V {FGW {bjDicI91KG2ndHjv [С => M {nyUFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ6Mki0PFA3Lz5 {OEK4xxYUg
HEK293 NV3tUIg3TnWwY4Tpc44h [XO | YYm = MWWyNEB2VQ>? M1rRfVI1KGi {cx? = MkDUTY5pcWKrdHnvckBw \ iCWTl \ hcJBp [S2rbnT1Z4VlKE6Ia3HwdIFDKGGldHn2ZZRqd25iaX6gTGVMOjl | IHPlcIx {KGG2IEKwJJVOKGGodHXyJFI1KGi {czDifUBlfWGuIHz1Z4ln \ XKjc3WgdoVxd3K2ZYKg [4Vv \ SCjc4PhfS => MWW8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zQDh5M {OwN {c, Ojh60005 {OzNFM9]
RAW264.7 MU \ GeY5kfGmxbjDhd5NigQ>? Мкм4НлАхфУ1? Мо \ UNkBpenN? MkSzTY5pcWKrdHnvckBw \ iCQRnvhdJBiSiCwdXPs [YFzKHS {YX7zcI9k [XSrb36gbY4hVFCVLYP0bY12dGG2ZXSgcY92e2ViUlHXNlY1NjdiY3XscJMh [XRiMkCgeW0heHKndILlZZRm \ CCob4KgNkBpenNiZn; scI94 \ WRiYomgUHBUNWmwZIXjeIlwdiCkeTDERXBKNXO2YXnubY5oKGKjc3XkJIludXWwb3 \ seY9z \ XOlZX7j [UBucWO {b4Pjc5Bq [yCvZYToc4Q> MXK8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zQTd3OUeyOUc, Ojl5NUm3NlU9N2F
BGC823 NFnDSZNHfW6ldHnvckBie3OjeR? = M3KyV | UhfU1? NX \ SOXpvOTJiaILz NX; EblN7UW6qaXLpeIlwdiCxZjDjc4xwdnliZn; ycYF1cW: wIHnuJIh3dWGwIFLHR | gzOyClZXzsd {BifCB3IIXNJJRz \ WG2ZXSg [o9zKDF {IHjyd {Bnd2yub4fl [EBjgSCrbnP1ZoF1cW: wIHnuJIRzfWdiZoLl [UBU \ WSrdX2g [o9zKDF2IHThfZMh [nliY4L5d5RidCC4aX; s [ZQhe3SjaX7pcoch [мГс | ZXSgZZN {[Xl? NVn3fXNQRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMki4PFEzQDZpPkKh5PFgyO;
SGC7901 NUHrRmRvTnWwY4Tpc44h [XO | YYm = Mn3aOUB2VQ>? NXTnRmc2OTJiaILz M3HsdmlvcGmkaYTpc44hd2ZiY3; sc456KG [xcn3heIlwdiCrbjDoeY1idiCVR1O3PVAyKGOnbHzzJIF1KDVidV2geJJm [XSnZDDmc5IhOTJiaILzJIZwdGyxd3XkJIJ6KGmwY4XiZZRqd25iaX6g [JJ2 \ yCocnXlJI1m \ Gm3bTDmc5IhOTRiZHH5d {BjgSClconzeIFtKH [rb3zleEB {fGGrbnnu [{Bj [XOnZDDhd5NigQ>? NUPGcYdHRGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMki4PFEzQDZpPkKh5PDgyO;
RAW264.7 MlXuSpVv [3Srb36gZZN {[Xl? NHnuSHEyOCC3TR? = M13mPFIhcHK | MnPlTY5pcWKrdHnvckBw \ iCOUGOtbY5lfWOnZDDJUE03KG2UTlGg [ZhxemW | c3nvckBqdiCvb4Xz [UBTSVd {NkSuO {Bk \ WyuczDheEAyOCC3TTDwdoUucW6ldXLheIVlKG [xcjCyJIhzeyCkZX \ vdoUhVFCVIIP0bY12dGG2aX; uJIZweiB {NDDodpMh [nlicWLUMXBEWiCvZYToc4Q> M4LafFxiKHSjcnfleF0oZ2KuYX7rK {BpemWoPTfoeJRxezpxL4D1Zo1m \ C6wY3LpMo5tdS6waXiu [493NzJ5MEO4OFk4Lz5 {N6}
RAW264.7 M1; LeGZ2dmO2aX; uJIF {e2G7 NXHETHZzOTBidV2 = MYWyJIhzew>? M4n4PWlvcGmkaYTpc44hd2ZiTGDTMYlv \ HWlZXSgTWwuOWKndHGgcXJPSSCneIDy [ZN {Cw: wIHnuJI1wfXOnIGLBW | I3PC55IHPlcIx {{KGG2IEGwJJVOKHC ZT3pcoN2 [mG2ZXSg [o9zKDJiaILzJIJm \ м: {ZTDMVHMhe3SrbYXsZZRqd25iZn; yJFI1KGi {czDifUByWlRvUFPSJI1mfGixZB = NWrSTGp3RGFidHHy [4V1RSehYnzhcosoKGi {ZX [9K4h2fHC | Oj: vdJVjdWWmLn7jZokvdmyvLn7pbE5od3ZxMkewN | g1QTdpPkKDlNFM];
RAW264.7 NF \ ROJNHfW6ldHnvckBie3OjeR? = M4D4UVExKHWP NVLjc2Z5OiCqcoO = MUDJcohq [mm2aX; uJI9nKEySUz3pcoR2 [2WmIHnOU3MhdVKQQTDlfJBz \ XO | аХ; uJIlvKG2xdYPlJHJCXzJ4ND63JINmdGy | IHH0JFExKHWPIIDy [U1qdmO3YnH0 [YQh \ м: {IEKgbJJ {KGKnZn; у [UBNWFNic4TpcZVt [XSrb36g [o9zKDJ2IHjyd {BjgSCzUmStVGNTKG2ndHjv [C => MU [8ZUB1 [XKpZYS9K39jdGGwazegbJJm \ j1paIT0dJM7Ny: ydXLt [YQvdmOkaT7ucI0vdmmqLnfvek8zPzB | OES5O {c, OjdyM {i0PVc9N]

Сигнальный путь IKK / NF-κB требует, чтобы Моргана управляла метастазами рака груди

Культура клеток

Клеточные линии человека и мыши MDA-MB-231, HEK293, эмбриональные фибробласты мыши (MEF) и 4T1 культивировали в DMEM среда (Thermo Fisher Scientific) с 10% FBS (Евроклон) и 1% пенициллина стрептомицином (Thermo Fisher Scientific).Клетки ВТ549 человека культивировали в среде RPMI (Thermo Fisher Scientific) с 0,023 МЕ мл инсулина -1 (Sigma Aldrich), 10% FCS (Euroclone) и пенициллин-стрептомицином (Thermo Fisher Scientific). Клетки MCF10A человека поддерживали в среде DMEM / F12 Ham's 1: 1, 5% лошадиной сыворотке (Thermo Fisher Scientific), инсулине (10 мкг мл -1 , Sigma Aldrich), гидрокортизоне (0,5 мкг мл -1 , Sigma Aldrich), эпидермальный фактор роста (EGF 20 нг / мл -1 , Sigma Aldrich) и пенициллин-стрептомицин (Thermo Fisher Scientific).Клетки HeLa человека и мыши E0771 культивировали в среде RPMI (Thermo Fisher Scientific) с 10% FBS (Euroclone) и 1% пенициллина стрептомицином (Thermo Fisher Scientific). Мышиные клетки NIH-3T3 поддерживали в среде DMEM (Thermo Fisher Scientific) с 10% FCS (Thermo Fisher Scientific) и 1% пенициллина-стрептомицина (Thermo Fisher Scientific).

Клеточные линии MCF10A, MCF7, BT549, MDA-MB-231, HEK293, NIH-3T3 и 4T1 были приобретены из Американской коллекции типовых культур и культивированы в условиях, указанных поставщиком.E0771 были получены от Тебу-Био. Эмбриональные фибробласты мыши получали из эмбрионов мыши 20 . Клетки обычно тестировались на заражение микоплазмами.

Нокдаун Морганы в MDA-MB-231, BT549, HeLa, HEK293, 4T1 и E0771 выполняли путем инфицирования клеток лентивирусными частицами pGIPZ, экспрессирующими две разные shРНК морганы, вместе с TurboGFP (Open Biosystems). BT549, MCF10A, MCF7 и NIH-3T3, сверхэкспрессирующие Morgana, были получены с использованием лентивирусного вектора pLVX, кодирующего Morgana мыши, слитого с тегом myc.Сверхэкспрессия MMP9 была получена при заражении BT549 и MDA-MB-231 с PLX304-MMP9. Подавление HSP90 и CDC37 в MDA-MB-231 осуществляли путем инфицирования клеток лентивирусными частицами pLKO, экспрессирующими две разные shРНК HSP90 или CDC37. Глушение IκBα было получено с использованием лентивирусных частиц pGIPZ для MDA-MB-231 и вирусных частиц pLKO для 4T1 и E0771.

Плазмиды и кшРНК

Следующие кшРНК были получены от Open Biosystems: человеческие кшРНК CHORDC1 V2LHS_24674 и V2LHS_24745; shРНК IkBα человека V3LHS_410687, shРНК CHORDC1 мыши V2THS_24746 и V2THS_24674.Следующие кшРНК были получены от Sigma: кшРНК HSP90 человека NM_007355.2-232s1c1 и NM_007355.2-2239s21c1; shРНК CDC37 человека NM_007065.3–819s1c1 и NM_007065.3-818s1c1, shРНК IkBα мыши NM_010907.2-235s21c1. IKK-2 WT (плазмида Addgene № 11103) и IKK-2 S177E S181E (плазмида Addgene № 11105) были подарками от Анджаны Рао. p1242 3x-KB-L был подарком Билла Сагдена (плазмида Addgene № 26699), а 3xAP1pGL3 (3xAP-1 в pGL3-basic) был подарком Александра Дента (плазмида Addgene № 40342).

Антитела и реагенты

Вестерн-блоттинг и иммунопреципитация были выполнены с использованием следующих первичных самодельных антител: моноклональное антитело против Morgana (P1PP0) было создано в нашей лаборатории с использованием слитого белка GST-morgana в качестве антигена 20 .Были использованы другие коммерчески доступные антитела: Винкулин (Sigma, SAB4200080, 1: 5000), CHORDC1 (Sigma, HPA041040, 1: 1000), MMP9 (Abcam, ab76003, 1: 1000), MMP2 (Santa Cruz, 8835, 1: 500). , HSP90 (Санта-Крус, 13119, 1: 1000), P-IkBα Ser32-36 (Санта-Крус, 8404, 1: 500), P-IkBα Tyr42 (Abcam, ab24783, 1: 1000), IkBα (Cell Signaling, 4814 , 1: 1000), IKKα (Cell Signaling, 11930, 1: 1000), IKKα (Cell Signaling, 2682, 1: 100 для экспериментов по коиммунопреципитации), IKKβ (Cell Signaling, 8943, 1: 1000), IKKγ (Santa Cruz, 8032, 1: 500), αTubulin (Sigma, T5168, 1: 8000), MBP (Cell Signaling, 2396, 1: 1000), TNF-R1 (Santa Cruz, 8436, 1: 500), TAK-1 ( Санта-Крус, 166562, 1: 500), p-AKT (Cell Signaling, 9271, 1: 1000), AKT (Cell Signaling, 4691, 1: 1000), CDC37 (Santa Cruz, 5617, 1: 500), P- IKKα / β (Cell Signaling, 2697, 1: 1000).

TNFα (300-01A и 315-01A) был приобретен у Peprotech, ингибитор IKKβ PS1145 (P6624), ингибитор ROCK Y27632 (Y0503), ингибитор PTEN VO-OHpic (V8639) и ингибитор AKT GSK69093 (SML0428). были от Sigma. BEZ235 (S1009) был приобретен в компании Selleckchem.

Лентивирусная трансдукция

Супернатанты, содержащие вирус, собирали через 48 часов после котрансфекции pCMV-VSV-G, pCMV Δ8.2 и вектора, содержащего shРНК или ORF, в клетки HEK293T, а затем добавляли к клеткам-мишеням.Затем клетки отбирали с помощью 10 мкг мл -1 пуромицина 17 .

Анализ роста, не зависящего от анкеровки

Анализ образования колоний на мягком агаре на MDA-MB-231 проводили путем ресуспендирования клеток в полной среде DMEM (Gibco-BRL), содержащей 0,3% агарозы с низким гелеобразованием (Sigma-Aldrich), и посевом клеток в трех экземплярах в 6-луночные планшеты, содержащие 2 мл слоя затвердевшего 0,6% агара (Sigma-Aldrich). Через 2 недели колонии окрашивали нитросиним тетразолием (Sigma-Aldrich), фотографировали с помощью микроскопии Zeiss (Carl Zeiss) и подсчитывали колонии с помощью программного обеспечения ImageJ.

Анализ пролиферации клеток

Кривые роста клеток MDA-MB-231, BT549, 4T1 и E0771 получали путем посева 1 × 10 4 клеток и окрашивания клеток 0,1% кристаллическим фиолетовым в указанные моменты времени. После окрашивания лунки обесцвечивали 20% уксусной кислотой и измеряли оптическую плотность раствора кристаллического фиолетового при 595 нм.

Желатиновая зимография

Для желатиновой зимографии кондиционированные среды и экстракты общего белка собирали из конфлюэнтных клеток MDA-MB-231, выдержанных в бессывороточной среде в течение 24 часов.Образцы подвергали электрофорезу с использованием 10% денатурирующих полиакриламидных гелей, содержащих 0,1% желатина. После электрофореза гель ренатурировали 25% тритоном в dH 2 O и инкубировали при 37 ° C в течение 16 часов в буфере, состоящем из 500 мМ трис-HCl, pH 7,8; 2 M NaCl и 50 мМ CaCl 2. Затем гели окрашивали 0,5% кумасси синим в 5% метаноле и 10% уксусной кислотой в dH 2 O и обесцвечивали 10% метанолом, 5% уксусной кислотой в dH 2 O 58 .Полосы на гелях были количественно определены с использованием программного обеспечения ImageJ.

Иммунопреципитация и вестерн-блоттинг

MDA-MB-231 или BT549 лизировали лизисным буфером (25 мМ Трис-HCl pH 8, 1 мМ MgCl 2 , 10 мМ NaF, 1 мМ PMSF, 1 мМ Na 3 VO 4 и коктейль ингибиторов протеаз (Roche)). После лизиса клетки центрифугировали при 1677 g в течение 5 минут, а затем супернатанты ультрацентрифугировали при 256365 g в течение 1 часа. 500 нг экстрактов общего белка инкубировали в течение ночи при 4 ° C с 5 мкг выбранного антитела, затем добавляли покрытую белком G сефарозу в течение 45 минут (GE Healthcare).Гранулы промывали 10 раз буфером для лизиса и ресуспендировали в буфере Лэммли. Для вестерн-блоттинга клетки лизировали в трис-буферном физиологическом растворе с 1% Triton X-100, плюс ингибиторы фосфатазы и протеаз. Экстракты общего белка (30–50 мкг) анализировали с помощью вестерн-блоттинга 59 и детектировали хемилюминесцентным реагентом LiteAblot (Euroclone). Интенсивность полос определяли количественно с использованием программного обеспечения Quantity One (Bio-Rad). Полные сканы наиболее важных вестерн-блоттингов представлены на дополнительном рис.12.

Анализ инвазии через лунки

Анализы инвазии для MDA-MB-231 и BT549 проводили с использованием инвазионных камер BioCoat TM Matrigel с размером пор 8,0 мкм (Becton Dickinson). Клетки предварительно голодали в течение 24 часов. Затем клетки (75 × 10 3 ) помещали в верхнюю камеру в среду без сыворотки или факторов роста, нижние камеры заполняли полной средой для выращивания. Через 24 часа мигрировавшие клетки, присутствующие на нижней стороне мембраны, были зафиксированы в 2.5% глутарового альдегида и окрашивают 0,1% кристаллическим фиолетовым. Для MDA-MB-231 трансвелл были сфотографированы с помощью микроскопа Olympus IX70. Инвазию оценивали путем измерения площади, занимаемой мигрировавшими клетками, с помощью программного обеспечения ImageJ. Для BT549 поглощение инвазии измеряли после обесцвечивания кристаллического фиолетового 20% уксусной кислотой, а поглощение раствора кристаллического фиолетового измеряли при 595 нм.

Анализы опухолей и метастазов in vivo

Эксперименты проводились в соответствии с этическими принципами Директивы Совета Европейских сообществ (2010/63 / EU).Экспериментальное одобрение было получено Министерством здравоохранения Италии. Экспериментальный анализ метастазов и эксперимент по спасению in vivo с использованием кшРНК IκBα проводили путем инъекции 5 × 10 5 клеток MDA-MB-231 (в PBS) в хвостовую вену самок мышей NSG с иммунодефицитом в возрасте 7 недель (Charles River Laboratories) . Через 4 недели мышей вскрывали и подсчитывали макрометастазы на стереомикроскопе Nikon SMZ1000. Спонтанные метастазы оценивали у самок мышей NSG с иммунодефицитом в возрасте 7 недель, которым инъецировали 1 × 10 6 клеток MDA-MB-231 (в PBS) и рассекали через 5 недель.Подсчет макрометастазов проводили на стереомикроскопе Nikon SMZ1000. 1 × 10 5 клеток 4T1 в 100 мкл PBS (смешанного с матригелем в соотношении 1: 1) вводили подкожно самкам сингенных мышей BALB / c в возрасте 6 недель. Через 4, 10 или 30 дней мышей умерщвляли, опухоли удаляли и взвешивали. 2 × 10 5 клеток E0771 в 100 мкл PBS (смешанного с матригелем в соотношении 1: 1) вводили подкожно самкам сингенных мышей C57BL / 6 в возрасте 6 недель. Через 6, 14 или 30 дней мышей умерщвляли, опухоли удаляли и взвешивали.Для всех исследований метастазов органы фиксировали формалином и заливали парафином, делали срезы и окрашивали гематоксилином и эозином (H&E). Микрометастазы оценивали на образцах с помощью микроскопа Olympus Bh3 как минимум на трех различных срезах. Метастатическая нагрузка оценивалась как процент площади метастазов в легких с использованием программного обеспечения Metamorph (Universal Imaging Corporation), усредняя по крайней мере шесть полей на образец. Опыты проводились вслепую. Самкам голых мышей с ослабленным иммунитетом в возрасте 6 недель вводили подкожно 1 × 10 6 клеток MDA-MB-231 или BT549, и через 30 дней мышей умерщвляли, а опухоли, если они присутствовали, удаляли и взвешивали.

Выделение РНК и ПЦР в реальном времени

Общую РНК из клеток или опухолей выделяли с использованием реагента Trizol (Thermo Fisher Scientific), следуя рекомендациям производителя. РНК подвергали обратной транскрипции с использованием набора для обратной транскрипции кДНК высокой емкости Applied Biosystem. Анализ экспрессии генов выполняли с использованием анализа экспрессии генов TaqMan (Applied Biosystems) на системе определения последовательности ABI Prism 7900HT (Applied Biosystems). Мы использовали 18S (Thermo Fisher) в качестве эндогенного контроля на протяжении всего экспериментального анализа.Анализ выполняли с использованием метода Δ - Δ Ct для определения кратных изменений. Мы использовали специфические для генов праймеры и универсальную библиотечную систему зондов (Roche Applied Sciences). Праймеры перечислены в дополнительной таблице 4. Клетки обрабатывали или не обрабатывали TNF-α 10 нМ за 4 часа до экстракции РНК.

Анализ репортера люциферазы

Плазмиды для анализа люциферазы были приобретены у Addgene: p1242-3x-KB-L, содержащего 3 сайта связывания NF-kappaB перед геном люциферазы Firefly и 3xAP1pGL3, содержащие 3 сайта связывания AP-1 перед ген люциферазы светлячка.Для анализа люциферазы 8 × 10 4 клеток высевали на 24-луночный планшет. Через 24 часа клетки котрансфицировали с использованием липофектамина 2000 (Invitrogen) 150 нг вектора pRL-TK (PROMEGA), содержащего конструкцию люциферазы Renilla , используемой в качестве нормализатора и внутреннего контроля, и 650 нг репортерного вектора ( p1242-3x-KB-L или 3xAP1pGL3), или с пустым вектором pGL2 или pGL3 соответственно (Promega). Через 24 часа трансфекции клетки обрабатывали 10 нМ TNF-α и через 24 часа проводили анализ двойного люциферазного репортера с помощью прибора Glomax (Promega).Результаты рассчитываются как кратные изменения и показаны как средние значения активности люциферазы Firefly, нормализованной по активности люциферазы Renilla.

Анализ киназы IKKβ

Активность IKKβ детектировали путем проведения анализа холодной киназы 59 . Клетки MDA-MB-231 лизировали в IP-буфере (Hepes 50 мМ pH 7,6, NaCl 150 мМ, EDTA 1 мМ, 0,1% NP40, 10% глицерин, ингибиторы протеаз и фосфатаз) с последующим центрифугированием при 45,346 × g для 15 мин. IKKβ иммунопреципитировали из равного количества белковых экстрактов, и гранулы белка G ресуспендировали в киназном буфере (20 мМ Hepes, pH 7.6, 20 мМ MgCl 2 , 10 мМ NaF, 0,1 мМ Na 3 VO 4 , 5% глицерина, 1 мМ DTT, смесь ингибиторов протеаз Roche и 1 мМ PMSF). Затем мы добавили АТФ (10 мкМ) и 1 мкг субстрата IKBα (Abcam) и 1 мкг MBP (мальтозо-связывающий белок) или 1 мкг MBP-Morgana или 20 мкМ ингибитора IKKβ PS1145 до объема 25 мкл при 30 °. C в течение 10 мин. Реакции останавливали добавлением равного объема 2 × буфера Лэммли с последующей инкубацией при 95 ° C в течение 10 мин. Киназную активность определяли с помощью вестерн-блоттинга с использованием антител P-IκBα и IκBα.

Дальний запад

Всего 1 мкг рекомбинантных белков жертвы обрабатывали на SDS-PAGE и переносили на нитроцеллюлозную мембрану. Белки денатурировали путем инкубации мембраны в буфере AC (100 мМ NaCl, 20 мМ Трис pH 7,6, 0,5 мМ ЭДТА, 10% глицерина, 0,1% Твин 20, 2% сухого обезжиренного молока и 1 мМ ДТТ), содержащего 6 М гуанидин- HCl в течение 30 мин при комнатной температуре. Затем с буфером AC, содержащим 3 М гуанидин-HCl, в течение 30 мин при комнатной температуре. Затем следует инкубация с буфером AC, содержащим 0.1 M и без гуанидин-HCl при 4 ° C в течение 30 мин и 1 ч соответственно 60 . После блокирования 5% молоком в течение 1 ч при комнатной температуре мембрану инкубировали с приманкой рекомбинантным белком MBP-Morgana в течение ночи при 4 ° C. Хемилюминесцентное обнаружение проводили после инкубации мембраны с первичным (1 час при комнатной температуре) и вторичным антителом (1 час при комнатной температуре).

Проточная цитометрия

Суспензии единичных клеток из опухолей и легких мышей получали механическим и ферментативным разрушением в PBS с 1 мг мл -1 коллагеназы P (Roche) в течение 1 часа.Клетки в суспензии фильтровали через сетчатый фильтр для клеток 40 мкм и центрифугировали в течение 5 мин при 120 g. После лизиса эритроцитов FcR блокировали антителом против CD16 / CD32 (Becton Dickinson), а клетки окрашивали указанными конъюгированными с флуорохромом антителами (дополнительная таблица 5) и пропидиум йодидом (Sigma) для анализа жизнеспособных клеток. Обнаружение лимфоидных клеток, образцы были окрашены антителами к CD45, CD3, CD4, CD8, CD49b, B220 и γδ TCR, и% был рассчитан при стробировании популяции CD45 +, в то время как образцы для анализа миелоидных и эндотелиальных клеток были окрашены антигенами. -CD45, CD11b, F4 / 80, Ly6C, Ly6G, CD206 и CD31 и представлены как процент миелоидных клеток в популяции CD45 + или эндотелиальных клеток CD31 + в популяции CD45 - 61 .Подмножества дендритных клеток (DC) окрашивали антителами против CD45, CD11b, CD11c, CD24, CD64, IA / IE + и Ly6G 62 . Процент нейтрофилов рассчитывали как клетки CD45 + , CD11b + , F4 / 80 -, Ly6C + и Ly6G + . Процент естественных клеток-киллеров (NK) был рассчитан как CD45 + , CD3 - и CD49b + , а процент NKT рассчитан как CD45 + , CD3 + и CD49b + .Для каждого анализа было проанализировано в общей сложности не менее 20000 живых клеток CD45 + . Проточный цитометрический анализ выполняли на BD FACSVerse с использованием программного обеспечения BD FACSSuite (Becton Dickinson).

Гель-фильтрационная хроматография

Гель-фильтрационная хроматография выполнялась на колонке Superose-6 10/300 GL (GE Healthcare) с использованием системы очистки AKTA (GE Healthcare). Белковый экстракт загружали на колонку и разделяли в буфере для гель-фильтрации (25 мМ Трис-HCl, pH 8.0,1 мМ MgCl 2 , 10% глицерин), при скорости потока 0,3 мл мин -1 и 0,5 мл фракции собирали. Стандарты молекулярной массы (GE Healthcare), использованные для калибровки колонки, включали синий декстран (2000 кДа), тиреоглобулин (669 кДа), ферритин (440 кДа), каталазу (240 кДа) и альдолаза (158 кДа). Фракции непосредственно анализировали вестерн-блоттингом после концентрирования с использованием Nanosep 3 K или иммунопреципитировали антителом против Морганы и анализировали вестерн-блоттингом.

Microarray

Общую РНК экстрагировали с использованием набора Trizol и абсолютной РНК miRNA (Agilent) в соответствии с инструкциями производителя.Всего 1 мкг общей РНК амплифицировали с помощью набора ammino-allyl message amp II (Ambion) и метили Cy3 (GE-Heathcare) с использованием протокола непрямого мечения. всего 200 нг меченой РНК гибридизовали на стеклянных решетках Agilent SurePrint G3 Human Gene Expression 8 × 60 К. Стекло сканировали с помощью сканера Agilent, а изображения анализировали с помощью программного обеспечения Agilent Feature Extraction Software (версия 10.7.3.1). Затем исходные данные обрабатывали с использованием пакета Bioconductor Limma (линейные модели для анализа микрочипов).Дифференциально экспрессируемые транскрипты получали с применением 0,01 в качестве отсечки скорректированного значения p и +1 или -1 в качестве отсечки logFC для повышения или понижения регуляции, соответственно.

Препарат РНК из образцов тканевых массивов

Это исследование было проведено в соответствии с этическими нормативными требованиями по обращению с биологическими образцами после получения соответствующего информированного согласия и одобрения институционального наблюдательного совета. Последующее исследование было выполнено на 152 образцах массива тканей, описанных ранее 14 .РНК из 58 образцов человека получали с использованием набора для очистки ДНК и РНК MasterPure (Epicenter).

Статистическая значимость

Для расчета размера выборки использовался тест Фишера с одним хвостом. Каждый эксперимент повторяли три и более раз. Данные представлены в виде средних значений ± стандартная ошибка среднего. Для статистического анализа значимость проверялась с использованием двустороннего критерия Стьюдента t или, при необходимости, одно- или двустороннего дисперсионного анализа с поправкой Бонферрони. Минимальное значение p <0.05 считался статистически значимым. Статистический анализ выполняли с использованием GraphPad Prism 4. Тест Мантела-Кокса использовали для построения кривых выживаемости Каплана-Мейера.

Статистика для корреляционного анализа Спирмена

Корреляционный анализ Спирмена был выполнен с использованием языка R 63 , набора Rstudio 64 и функции «cor.test», method = «spearman». P Значения были скорректированы для многократного тестирования с помощью функции «p.adjust», method = «fdr».Данные по экспрессии генов (HiseqV2) и данные по белку RPPA-RBN TCGA BRCA, образцы, версия: 2015-02-24, были загружены из UCSC Cancer Genome Browser 65,66,67,68 (http: // genome-Cancer .ucsc.edu). Данные по экспрессии генов и метаданные 54 клеточных линий рака молочной железы 38 были загружены из XENA Cancer Browser (xenabrowser.net).

Анализ GSEA

Анализ обогащения набора генов 69, 70 был выполнен путем запуска инструмента GSEAPreranked из командной строки (gsea2-2.2.0.jar со следующими параметрами: -mode Max_probe, -norm meandiv, -nperm 1000, -rnd_seed timestamp, -set_max 500 и-set_min 15). Показатель ранжирования списка был рассчитан на основе коэффициента корреляции Спирмена Rho между уровнями экспрессии CHORDC1 и всеми генами, присутствующими в анализируемой когорте (что касается TCGA BRCA, 20530 генов в когорте образцов первичной опухоли 1095; в то время как для образцов Хейзера 18632 гена в 54 груди линии раковых клеток). Наборы генов, использованные в анализе, были загружены (16 мая 2016 г.) с веб-сайта Broad Institute GSEA (http: // software.broadinstitute.org/gsea/index.jsp), база данных MSigDB v5.2.

Доступность данных

Данные микрочипов, которые подтверждают результаты этого исследования, были депонированы в Gene Expression Omnibus с кодом доступа GSE86463. Все другие соответствующие данные доступны у соответствующих авторов.

Разработка новых миметиков NEMO-связывающего домена для ингибирования активации IKK / NF-κB

Abstract

Ядерный фактор κB (NF-κB) является фактором транскрипции, важным для регуляции врожденного и адаптивного иммунитета, клеточной пролиферации, апоптоза и старения.Нарушение регуляции NF-κB и его вышестоящего регулятора киназы IκB (IKK) способствует патогенезу множественных воспалительных и дегенеративных заболеваний, а также рака. Пептид из 11 аминокислот, содержащий существенный модулятор NF-κB (NEMO) -связывающий домен (NBD), происходящий от С-конца β-субъединицы IKK, действует как высокоселективный ингибитор комплекса IKK, нарушая ассоциацию IKKβ. и субъединица IKKγ NEMO. Модель фармакофоров на основе структуры была разработана для идентификации миметиков NBD путем скрининга in silico.Два оптимизированных ведущих миметика NBD, SR12343 и SR12460, ингибировали индуцированную фактором некроза опухоли α (TNF-α) и липополисахарид (LPS) активацию NF-κB, блокируя взаимодействие между IKKβ и NEMO и подавляя LPS-индуцированное острое воспаление легких у мышей. . Хроническое лечение мышечной дистрофии Дюшенна (МДД) на мышах с помощью SR12343 и SR12460 ослабляло воспалительную инфильтрацию, некроз и мышечную дегенерацию, демонстрируя, что эти низкомолекулярные миметики NBD являются потенциальными терапевтическими средствами для воспалительных и дегенеративных заболеваний.

Информация об авторе

Аберрантная повышающая регуляция ядерного фактора транскрипционного фактора κB (NF-κB) и киназы IκB (IKK), которая регулирует NF-κB, связана с различными воспалительными и дегенеративными заболеваниями у людей, включая старение. Таким образом, разработка эффективных и специфических препаратов, способных снижать активность IKK / NF-κB, имеет значительный терапевтический потенциал. В этом исследовании вычислительный подход, основанный на структуре, был использован для скрининга низкомолекулярных ингибиторов белок-белкового взаимодействия между субъединицами IKKß и IKKγ комплекса IKK.Мы идентифицировали и разработали новый класс малых молекул, которые избирательно ингибируют активацию IKK / NF-κB путем диссоциации комплекса IKK, не влияя на передачу сигналов c-Jun N-концевой киназы (JNK) / p38-митоген-активируемой протеинкиназы (MAPK). Эти новые молекулы уменьшают вызванное липополисахаридом (ЛПС) острое воспаление у мышей и улучшают мышечную патологию в мышиной дистрофии Дюшенна (МДД) mdx , предполагая, что они могут иметь потенциальную клиническую применимость.

Образец цитирования: Zhao J, Zhang L, Mu X, Doebelin C, Nguyen W., Wallace C, et al.(2018) Разработка новых миметиков NEMO-связывающего домена для ингибирования активации IKK / NF-κB. ПЛоС Биол 16 (6): e2004663. https://doi.org/10.1371/journal.pbio.2004663

Академический редактор: Чайтан Хосла, Стэнфордский университет, Соединенные Штаты Америки

Поступила: 30 октября 2017 г .; Принято к печати: 21 мая 2018 г .; Опубликовано: 11 июня 2018 г.

Авторские права: © 2018 Zhao et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в документе и его вспомогательных информационных файлах.

Финансирование: Авторы не получали специального финансирования на эту работу.

Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

Сокращения: 3D, трехмерный; ADME / Tox, Поглощение, распределение, метаболизм, выведение и токсичность; Али, острое повреждение легких; ALP, щелочная фосфатаза; ALT, аланинаминотрансфераза; АСТ, аспартатаминотрансфераза; Бкл-2, В-клеточная лимфома 2; CD68, кластер дифференциации 68; ЦОГ-2, циклооксигеназа 2; DMD, Мышечная дистрофия Дюшенна; EMSA, анализ сдвига электрофоретической подвижности; eMyHC, тяжелая цепь эмбрионального миозина; ГРМД, мышечная дистрофия золотистого ретривера; GST, глутатион S-трансфераза; HEK293, клетки 293 эмбриональной почки человека; я.п., внутрибрюшинный; IC 50 , половина максимальной ингибирующей концентрации; ИКК, Киназа IκB; Ил-1, интерлейкин 1; iNOS, индуцибельная синтаза оксида азота; JNK, c-Jun N-концевую киназу; LPS, липополисахарид; LTβR, рецептор лимфотоксина β; МАПК, митоген-активированная протеинкиназа; MEF, эмбриональный фибробласт мыши; МТТ, Бромид 3- (4,5-диметилтиазол-2-ил) -2,5-дефенилтетразолия; п.д., необнаруживаемый; NBD, НЕМО-связывающий домен; НЕМО, Основной модулятор NF-κB; NF-κB, ядерный фактор κB; NLS, последовательность ядерной локализации; НЕТ, оксид азота; Pax7, парный бокс-белок 7; PDB, Банк данных белков; п-JNK, фосфо-c-Jun N-концевую киназу; PTD, домен трансдукции белка; ПУМА, модулятор апоптоза с повышенной регуляцией р53; qRT-PCR, количественная полимеразная цепная реакция в реальном времени; Правый руль, Домен Rel-гомологии; RMSD, среднеквадратичное отклонение; SAR, взаимосвязь структура – ​​деятельность; SD, стандартное отклонение; TA, передняя большеберцовая мышца; TCR, Рецептор Т-клеток; TNF-α, фактор некроза опухоли α; TRAF2, Фактор 2, связанный с рецептором TNF

Введение

Ядерный фактор κB (NF-κB) - это фактор транскрипции, необходимый для регуляции иммунных ответов, пролиферации клеток, апоптоза, эмбрионального развития, старения и рака [1].В клетках млекопитающих семейство NF-κB состоит из 5 субъединиц, RelA / p65, RelB, C-Rel, p50 (p105 / NF-κB1) и p52 (p100 / NF-κB2), все из которых содержат Rel-гомологию. домен (RHD), необходимый для гомо- или гетеродимеризации [1]. Димеры NF-κB изолируются в цитоплазме с помощью ингибирующего белка IκBα, который маскирует консервативную последовательность ядерной локализации (NLS) RelA / p65 для предотвращения ядерной транслокации [1]. При стимуляции IκBα претерпевает фосфорилирование, полиубиквитинирование и опосредуемую протеасомами деградацию, высвобождая димеры NF-κB, чтобы сделать возможным ядерную транслокацию [1].Этот активированный NF-κB понижает или регулирует экспрессию целевого гена за счет связывания с энхансером κB или элементами промотора [1]. Индукторы активности NF-κB включают провоспалительные цитокины, такие как фактор некроза опухоли α (TNF-α), интерлейкин-1 (IL-1) и липополисахарид (LPS), а также лиганды Т-клеточного рецептора (TCR). , генотоксический и окислительный стресс [1].

Активация NF-κB регулируется комплексом киназы IκB (IKK), состоящим из 2 каталитических субъединиц, IKKα и IKKβ, и регуляторной субъединицы, эссенциального модулятора NF-κB (NEMO) / IKKγ [2–4].Домены на С-концах IKKα и IKKβ, необходимые для взаимодействия с α-спиральной областью на N-конце NEMO, называются NEMO-связывающими доменами (NBD) [5]. Пептид из 11 аминокислот, полученный из домена NBD IKKβ (аминокислоты 735–745), может нарушать ассоциацию IKKβ и NEMO и снижать активацию NF-κB при слиянии с доменом трансдукции белка (PTD) для внутриклеточной доставки [5] .

Пептид NBD оказывает сильное терапевтическое действие на многочисленные модели воспалительных и дегенеративных заболеваний у мышей и других видов.Хроническое системное введение пептида NBD ослабляет макрофагально-опосредованный некроз и дегенерацию мышц у мышей mdx , мышиной модели мышечной дистрофии Дюшенна (МДД), а также модели МДД у собак с мышечной дистрофией золотистого ретривера (GRMD) [6 –8]. Точно так же пептид NBD улучшает активный хронический колит у мышей с дефицитом IL-10, не влияя на базальную активность NF-κB при системном введении [9]. Внутрисуставная инъекция пептида NBD также ослабляет синовиальное воспаление и тяжесть артрита на крысиной модели адъювантного артрита [10].Он также улучшает индуцированный воспалением остеокластогенез и артрит за счет подавления генов-мишеней NF-κB, TNF-α и IL-1β [11]. Системная доставка пептида NBD снижает тяжесть болезни Паркинсона за счет подавления активации нигральных микроглии и уменьшения потери дофаминергических нейронов, а также уменьшает нефропатию и атеросклероз у мышей с диабетом 1 типа [12–14]. Кроме того, пептид предотвращает индуцированное ЛПС воспаление легких у овец и улучшает легочную функцию на модели острого респираторного дистресс-синдрома у поросят путем местного применения [15, 16].Кроме того, клинические испытания пептида NBD для местного лечения диффузной крупноклеточной В-лимфомы у собак выявили снижение пролиферации злокачественных В-клеток [17]. Кроме того, хроническое системное введение пептида NBD задерживает начало и снижает тяжесть множественных симптомов старения и патологии у мышей Ercc1 - / Δ , мышиной модели прогерии человека [18].

Несмотря на эти сильные и разнообразные терапевтические эффекты пептидов PTD-NBD на животных моделях, стоимость синтеза пептида, короткий период полужизни пептида и отсутствие пероральной биодоступности ограничивают его клиническое применение.Таким образом, разработка малых молекул, которые имитируют пептид NBD, нацеленных на NBD IKKβ, чтобы нарушить его связывание с NEMO, может иметь клиническое применение. Здесь основанная на структуре модель фармакофора, которая имитирует эти взаимодействия, была получена из кристаллической структуры комплекса IKK с последующим виртуальным скринингом с использованием этой модели в сравнении с коммерчески доступными базами данных о молекулах, подобных лекарствам. Полученные совпадения были расставлены по приоритету с использованием фильтрации in silico по абсорбции, распределению, метаболизму, экскреции и токсичности (ADME / Tox) и молекулярной стыковке для определения совпадений с более высоким сродством.Используя их в качестве отправных точек, несколько раундов оптимизации медицинской химии привели к открытию соединений, способных ингибировать LPS- и TNF-α-индуцированную активацию NF-κB, нарушая связь между IKKβ и NEMO. Кроме того, эти соединения проявляли сильные терапевтические эффекты на мышиных моделях LPS-индуцированной эндотоксемии и МДД, что указывает на их потенциал в качестве терапевтических препаратов для клинического лечения заболеваний, вызванных активацией IKK / NF-κB.

Результаты

Создание модели фармакофора на основе структуры с использованием вычислительного подхода, основанного на консервативных взаимодействиях между IKKβ и NEMO

Распознавание малых молекул белками в значительной степени опосредовано комплементарностью поверхности молекул [19, 20].Таким образом, сайт белок-белкового взаимодействия между NEMO и IKKβ потенциально является хорошей мишенью для скрининга лекарств in silico. Чтобы исследовать химические особенности, необходимые для взаимодействия белок-белок, была использована рентгеновская структура комплекса NEMO / IKKβ, полученная из банка данных по белкам (PDB) (ID 3BRV), для создания фармакофора на основе структуры (рис. 1A). [21] с использованием модуля генерации фармакофоров LigandScout [22, 23]. Каждый взаимодействующий атом от каждого остатка был «переведен» в фармакофорный элемент, в результате чего фармакофор на основе структуры (рис. 1В) состоял из 8 элементов и 13 исключительных объемов, представляющих важные атомы из окружения белка.

Рис. 1. Разработка модели фармакофора на основе структуры для in silico скрининга миметиков NBD.

(A) Взаимодействующие остатки, извлеченные из рентгеновской структуры комплекса NEMO / IKKβ (PDB ID: 3BRV), использованного при создании модели фармакофоров на основе структуры [21]. (B) Трехмерное представление модели фармакофоров на основе структуры. Три гидрофобные группы (F2, F4 и F7: желтые сферы), 1 элемент акцептора водородной связи (F3: красная сфера), 1 донор водородной связи (F5: зеленая сфера), 1 положительная ионизируемая область (F8: синяя сфера) Показаны 1 отрицательно ионизируемый (F6: красная сфера) и 13 исключенных объемов (серые сферы).(C) Химические структуры 3 соединений, прошедших биологическое тестирование [24]. 3D, трехмерный; IKK, IκB киназа; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; PDB, Банк данных белков.

https://doi.org/10.1371/journal.pbio.2004663.g001

Эта фармакофорная модель была использована для скрининга подмножества набора данных лекарственного средства ZINC 10.0 (приблизительно 13,5 миллионов соединений) [24]. Мы идентифицировали 161 соединение, которое соответствовало по крайней мере 6 характеристикам из 8 фармакофорной модели.Двадцать совпадений имели среднеквадратичное отклонение (RMSD) <1 и были дополнительно расставлены по приоритету с использованием свойств, предсказанных ADME / Tox. Три соединения успешно прошли эти фильтры (рис. 1С).

Идентификация низкомолекулярных ингибиторов активации NF-κB

Чтобы определить, ингибируют ли небольшие молекулы, идентифицированные скринингом in silico, активацию NF-κB, использовали клеточную линию HEK293, стабильно экспрессирующую репортер люциферазы, управляемый синтетическим, NF-κB-зависимым промотором [25].Чтобы вызвать активацию NF-κB, клетки обрабатывали 10 нг / мл TNF-α и собирали через 3 часа после обработки для анализа активности люциферазы. Обработка ZINC120 слегка подавляла активацию NF-κB при концентрации 100 мкМ, тогда как активность люциферазы оставалась неизменной в клетках, обработанных ZINC05682974 или ZINC078 (фиг. 2A). Чтобы определить, ингибирует ли ZINC120 NF-κB дозозависимым образом, тестировали концентрации при 0, 6,25, 25, 50 и 100 мкМ. Только высокие концентрации (50 и 100 мкМ) соединения были способны значительно ингибировать TNF-α-индуцированную активацию NF-κB (рис. 2B) [25].

Рис. 2. Идентификация малых молекул, ингибирующих TNF-α-индуцированную активацию NF-κB.

(A) Клетки HEK293, стабильно экспрессирующие репортер люциферазы NF-κB, предварительно обрабатывали указанными небольшими молекулами при 100 мкМ в течение 30 минут с последующей стимуляцией TNF-α (10 нг / мл) в течение 3 часов. Активность люциферазы нормализовали для необработанных стимулированных контрольных клеток. Данные показывают средние значения 2 независимых экспериментов +/- SD. (B) Дозозависимый ответ ZINC120 тестировали с помощью анализа люциферазы NF-κB в клетках HEK293.Было проведено три независимых эксперимента, и показанные данные представляют собой среднее значение +/- SD. (C) Клетки HEK293 обрабатывали производными ZINC120 в концентрации 100 мкМ и проводили анализ люциферазы NF-κB для скрининга малых молекул с более сильным ингибирующим эффектом NF-κB. Данные показывают объединенные результаты 5 независимых экспериментов и представляют собой среднее значение +/- SD. (D) Клетки HEK293 культивировали в присутствии 100 мкМ указанных производных в течение 24 часов, и выживание клеток определяли с помощью анализа МТТ. Жизнеспособность клеток рассчитывали путем нормализации к необработанным клеткам.(E) Дозозависимые ингибирующие эффекты определяли для ZINC5 при 0, 25, 50 и 100 мкМ с использованием анализа люциферазы NF-κB. (F) HEK293 культивировали в присутствии ZINC5 в указанных концентрациях в течение 24 часов, и выживаемость клеток оценивали с помощью анализа МТТ. Данные представляют собой среднее значение +/- SD из 4–5 независимых экспериментов. * P <0,05; ** P <0,01; *** P <0,001. Базовые данные можно найти в S1 Data. НЕК293, клетки 293 почки эмбриона человека; МТТ, 3- (4,5-диметилтиазол-2-ил) -2,5-дефенилтетразолийбромид колориметрический анализ для оценки метаболической активности клеток; NF-κB, ядерный фактор κB; TNF-α; фактор некроза опухоли α; SD, стандартное отклонение.

https://doi.org/10.1371/journal.pbio.2004663.g002

Для идентификации миметиков NBD с более высокой биологической активностью, чем ZINC120 или пептид NBD, база данных ZINC 10.0 (примерно 13,5 миллионов соединений) была проверена in silico на структурные аналогичные соединения [26]. Было идентифицировано пятнадцать аналогов с показателем сходства> 90%, и 13, прошедшие все фильтры ADME / Tox, были приобретены для тестирования (таблица S1). Четыре соединения - ZINC9642366 (Zinc1), ZINC3369392 (Zinc5), ZINC3269261 (Zinc8) и ZINC3264658 (Zinc9), а также ингибитор активного сайта IKK, IKKi VII, используемый в качестве положительного контроля, - значительно снижали активность NF-κB, в то время как другие аналоги имели минимальные эффекты (рис. 2С).Чтобы исключить возможность того, что снижение, наблюдаемое в анализах люциферазы, было связано с токсичностью лекарственного средства, для оценки жизнеспособности клеток был проведен колориметрический анализ МТТ с использованием 3- (4,5-диметилтиазол-2-ил) -2,5-дефенилтетразолия бромида. Обработка ZINC8 привела к 40% гибели клеток через 24 часа, что позволяет предположить, что по крайней мере часть снижения активности люциферазы может быть отнесена к цитотоксичности (рис. 2D). Поскольку ZINC5 продемонстрировал сильную ингибирующую эффективность NF-κB в культуре клеток с небольшой токсичностью (менее 10%), он был протестирован на дозозависимое ингибирование NF-κB.ZINC5 показал больший ингибирующий эффект по сравнению с ZINC120 без явной клеточной токсичности (рис. 2E и 2F).

Миметики NBD ингибируют активность связывания ДНК NF-κB

Для подтверждения того, что миметики NBD снижают активность киназы IKK, фосфорилирование IκBα с помощью IKK в ответ на 10 нг / мл TNF-α измеряли вестерн-блоттингом через 0, 5 и 10 мин после стимуляции. ZINC5 снижал уровень p-IκBα после стимуляции, в то время как ZINC120 приводил к менее устойчивому снижению (рис. 3A).Чтобы определить, снижают ли миметики также активность связывания ДНК NF-κB, был проведен анализ сдвига электрофоретической подвижности (EMSA) как in vitro, так и in vivo. ZINC5 и ZINC120 были протестированы на клетках C2C12 (линия клеток миобластов мыши) при 200 мкМ, и было показано, что они ингибируют TNF-α-индуцированную активность связывания ДНК NF-κB (рис. 3B). Точно так же однократная внутрибрюшинная (внутрибрюшинная) инъекция любой из этих двух небольших молекул в дозе 10 мг / кг ингибировала активность связывания ДНК NF-κB в квадрицепсе, которая хронически повышается у мышей mdx (рис. 3C).Однако ZINC5 был крайне нестабильным даже в средах для культивирования клеток, содержащих FBS, тогда как ZINC120 был относительно более стабильным. Добавление ацетонитрила увеличивало стабильность обоих соединений ZINC, особенно ZINC 5 (рис. 3D).

Рис. 3. Две идентифицированные небольшие молекулы снижают активность связывания ДНК NF-κB in vivo и in vitro.

(A) Уровни p-IκBα с обработкой или без обработки в ответ на TNF-α определяли с помощью вестерн-блоттинга. Клетки HEK293 предварительно обрабатывали ДМСО, ZINC120 (100 мкМ) и ZINC5 (100 мкМ) в течение 30 минут с последующей стимуляцией 10 нг / мл TNF-α в течение 0, 5 и 10 минут.Клеточные лизаты готовили для иммуноблоттинга против p-IκBα. GAPDH использовался в качестве контроля загрузки. (B) EMSA-анализ, определяющий активность связывания ДНК NF-κB, проводили в миобластах C2C12. Клетки предварительно обрабатывали 200 мкМ ДМСО, ZINC120 и ZINC5 в бессывороточной среде в течение 1 часа. Затем добавляли TNF-α до конечной концентрации 10 нг / мл и инкубировали в течение 15 мин. Ядерный экстракт был получен для анализа EMSA. (C) EMSA-анализ, оценивающий активность связывания ДНК NF-κB in vivo, проводили с квадрицепсами мышей mdx.Однократная доза ZINC120 и ZINC5 в дозе 10 мг / кг вводилась внутрибрюшинно. Квадрицепс собирали через 1 и 2 часа после инъекции для анализа EMSA. (D) Динамика фармакокинетики ZINC5 и ZINC120 в среде FBS или среде FBS, содержащей ацетонитрил. Базовые данные можно найти в S1 Data. EMSA, анализ сдвига электрофоретической подвижности; НЕК293, клетки 293 почки эмбриона человека; внутрибрюшинно, внутрибрюшинно; NF-κB, ядерный фактор κB; t 1/2 , период полураспада; TNF-α; фактор некроза опухоли α.

https: // doi.org / 10.1371 / journal.pbio.2004663.g003

Оптимизация миметиков NBD

ZINC5 и ZINC120 оба содержат сложноэфирные связи, что приводит к их быстрой деградации в присутствии сыворотки (рис. 3D). Для повышения биоактивности и стабильности были проведены исследования взаимосвязи структура-активность (SAR), и было синтезировано и протестировано более 100 малых молекул. Были идентифицированы четыре основных миметика NBD, которые продемонстрировали усиленный ингибирующий эффект по сравнению с исходными соединениями ZINC, в том числе 3 неэфира - SR12343, SR12460 и SR12454 - и 1 сложный эфир SR11481 (рис. 4A и 4B).Эти 3 неэфира значительно ингибировали TNF-α-опосредованную активацию NF-κB с половинными максимальными ингибирующими концентрациями (IC 50 ) 11,34 мкМ, 20,24 мкМ и 37,02 мкМ, соответственно (Таблица 1, Фиг.4B и S1A Фиг.). Сложный эфир SR11481 оказался не таким эффективным (IC 50 45,03 мкМ), возможно, из-за наличия сложноэфирной связи (рис. 4В). Репортер люциферазы рениллы котрансфицировали для нормализации. Чтобы определить, ограничивается ли ингибирующее действие миметиков TNF-α-опосредованной индукцией IKK / NF-κB, была исследована LPS-опосредованная активация NF-κB.Активность NF-κB индуцировали в Raw 264.7 с помощью 1 мкг / мл LPS в течение 2 часов, а IKKi VII (2 мкМ) и пептид 8K-NBD (400 мкМ) включали в качестве положительных контролей. Экспрессия генов-мишеней NF-κB циклооксигеназы 2 (COX-2), IL-6, IL-1β, TNF-α, IκBα и индуцибельной синтазы оксида азота (iNOS) определялась количественной полимеразной цепной реакцией в реальном времени (qRT -PCR) анализ. SR12460 и SR12454, которые более похожи по структуре, чем другие 2 миметика, были способны значительно ингибировать транскрипцию всех тестируемых генов-мишеней NF-κB (рис. 4C).SR12343 демонстрировал профиль, аналогичный профилю пептида 8K-NBD, показывая значительное ингибирование экспрессии COX-2, IL-6 и iNOS при гораздо более низкой концентрации (50 мкМ) по сравнению с пептидом NBD (400 мкМ). SR11481 не вызывал заметного подавления генов-мишеней NF-κB, вероятно, из-за его низкой стабильности. IKKi VII, хотя и способен подавлять большую часть экспрессии гена-мишени NF-κB, не смог подавить экспрессию iNOS, которая значительно ингибировалась пептидом NBD и всеми неэфирными миметиками NBD. Это предполагает, что ингибиторы IKK, нацеленные на АТФ-связывающий карман, вероятно, подавляют экспрессию немного другого набора регулируемых NF-κB генов.

Рис. 4. Модифицированные свинцовые миметики NBD ингибируют TNF- и LPS-индуцированную активацию NF-κB, нарушая связь между NEMO и IKKβ.

(A) Структуры топовых миметиков NBD. (B) Измерение активации NF-κB в ответ на TNF-α с использованием двойных анализов репортера люциферазы. Клетки HEK293, котрансфицированные репортером люциферазы NF-κB и плазмидами SV40-Renilla, предварительно обрабатывали ДМСО или перечисленными небольшими молекулами при 0, 25, 50, 100 и 150 мкМ в течение 30 минут с последующей индукцией TNF-α в течение 3 часов.Приведенные данные являются репрезентативными для 2–3 независимых экспериментов. (C) Миметики NBD подавляли экспрессию генов-мишеней NF-κB в ответ на LPS. Необработанные клетки 264.7 предварительно обрабатывали указанными лекарствами в течение 30 минут, а затем стимулировали 1 мкг / мл LPS в течение 2 часов. Затем клетки собирали для выделения РНК и анализа qRT-PCR. Используемые концентрации лекарственного средства следующие: IKKi VII (2 мкМ), пептид 8K-NBD (200 мкМ), SR12343 (50 мкМ), SR12460 (50 мкМ), SR12454 (50 мкМ) и SR11481 (50 мкМ). Данные представляют 2 независимых эксперимента.(D) Продукция IL-6 мыши, индуцированная LPS, подавлялась миметиками NBD. Необработанные клетки 264,7, предварительно обработанные ДМСО или лекарственными средствами в указанных концентрациях, подвергали воздействию 1 мкг / мл LPS в течение 24 часов, и супернатант собирали для анализа ELISA на мышиный IL-6. * P <0,05; ** P <0,01. Базовые данные можно найти в S1 Data. НЕК293, клетки 293 почки эмбриона человека; IKK, IκB киназа; ИЛ-6, интерлейкин 6; ЛПС, липополисахарид; NBD, NEMO-связывающий домен; н.о., не обнаруживается; NEMO, существенный модулятор NF-κB; NF-κB, ядерный фактор κB; qRT-PCR, качественная полимеразная цепная реакция в реальном времени; TNF-α; фактор некроза опухоли α.

https://doi.org/10.1371/journal.pbio.2004663.g004

Таблица 1. IC 50 миметиков NBD.

Ингибирующие эффекты миметиков NBD на активацию NF-κB измеряли с помощью люциферазных анализов при нескольких концентрациях: 0, 25, 50, 100 и 150 мкМ. IC 50 миметиков NBD определяли на основе зависимой от дозы кривой с использованием GraphPad.

https://doi.org/10.1371/journal.pbio.2004663.t001

Для подтверждения результатов qRT-PCR, уровни продукции IL-6 в Raw 264.7 клеток, активированных LPS, анализировали с помощью ELISA. SR12460 и SR12454 были способны значительно ингибировать секрецию IL-6 дозозависимым образом (рис. 4D). Точно так же SR12343 ингибировал продукцию IL-6, но был не так эффективен, как SR12460 и SR12454, что согласуется с его более высоким IC 50 в клетках HEK293. Хотя SR11481 не смог значительно ингибировать IL-6 на уровне мРНК, наблюдалось значительное снижение накопления белка IL-6 через 24 часа. Более того, SR11481, по-видимому, более эффективен при более низкой концентрации 25 мкМ по сравнению с 50 мкМ.

Миметики NBD нацелены на взаимодействие NEMO / IKKß, чтобы ингибировать передачу сигналов NF-κB

Чтобы определить, нацелены ли новые миметики NBD на взаимодействие NEMO-IKKβ in vivo, коиммунопреципитации проводили с использованием экстрактов из макрофагов Raw 264.7 (фиг. 5A). Все 4 миметика уменьшают взаимодействие IKKβ-NEMO так же или лучше, чем пептид NBD, причем SR12343 является наиболее эффективным. SR12343 также уменьшал ассоциацию между NEMO и IKKβ в клетках Raw 264.7 дозозависимым образом (фиг. 5B).В этих условиях не наблюдалось взаимодействия между NEMO и фактором 2, связанным с рецептором TNF (TRAF2) или IκBα. Предыдущие исследования показали, что пептид NBD также ингибирует взаимодействие NEMO с IKKα [27]. Однако SR12343 оказывал лишь незначительное влияние на связывание NEMO / IKKα только в наивысшей дозе, предполагая, что эти ингибиторы влияют на взаимодействие NEMO / IKKα с гораздо меньшей эффективностью (рис. 5B). Чтобы продемонстрировать, что SR12343, который был наиболее эффективным миметиком в нарушении взаимодействия NEMO / IKKβ in vivo, непосредственно влияет на взаимодействие NEMO / IKKβ, были проведены исследования in vitro с использованием глутатион-S-трансферазы (GST) с использованием рекомбинантного GST-NEMO и ФЛАГ-IKKβ.Как показано на фиг. 5C, SR12343 был способен нарушить взаимодействие между GST-NEMO и FLAG-IKKβ даже при дозе 12,5 мкМ. Чтобы продемонстрировать, что снижение NF-κB-опосредованной транскрипции при стимуляции TNF-α и LPS (рис. 4) не связано с эффектами вне мишени, активацией сигнального пути NF-κB и путей митоген-активируемой протеинкиназы (MAPK). был исследован методом вестерн-блоттинга. Уровни фосфорилированного комплекса IKK, IκBα и p65 в ответ на TNF-α и LPS были снижены SR12343 (рис. 5D и 5E).Соответственно, деградация IκBα была частично снижена (рис. 5D и 5E). Однако не было изменений в уровнях N-концевой киназы фосфо-c-Jun (p-JNK), p-p38MAPK, общего JNK и p38MAPK при обработке SR12343 (150 мкМ) в ответ на TNF-α или LPS. стимуляция (рис. 5G и 5H). Эти результаты предполагают, что наблюдаемые ингибирующие эффекты SR12343 опосредуются непосредственно через IKK / NF-κB, но не из-за нецелевых эффектов, таких как пути JNK или p38MAPK. Обработка SR12343 также не оказывала влияния на активацию неканонического пути NF-κB рецептором против лимфотоксина β (LTβR), как показано неизмененным процессингом от p100 до p52 (фиг. 5F).

Рис. 5. Миметики NBD селективно ингибируют каноническую передачу сигналов NF-κB, воздействуя на ассоциацию NEMO с IKKβ.

(A) Анализ Co-IP, обнаруживающий взаимодействие IKKβ / NEMO. Необработанные клетки 264.7 были предварительно обработаны указанными лекарствами, ДМСО, пептидом 8K-NBD (400 мкМ), SR12460 (100 мкМ), SR12343 (100 мкМ), SR12454 (100 мкМ) и SR11481 (100 мкМ) в течение 30 мин, и затем клетки собирали для Co-IP. NEMO был исследован как средство контроля загрузки. (B) Необработанные клетки 264,7, предварительно обработанные SR12343 в указанных концентрациях (0, 25, 50, 100 и 150 мкМ) в течение 30 минут, подвергали анализу Co-IP.Затем NEMO-связывающие продукты анализировали на уровни IKKβ, IKKα, TRAF2 и IκBα (отрицательный контроль), и уровни NEMO использовали в качестве контроля нагрузки (левая панель). Правая панель показывает уровни белков во входных элементах управления (10% клеточного экстракта, используемого для Co-IP). (C) GST-NEMO (15 нМ), предварительно инкубированный с ингибиторами в указанных концентрациях, инкубировали с IKKβ-FLAG (15 нМ) в течение 30 минут при 30 ° C и выделяли с использованием глутатиона аргарозы. Уровни связывания IKKβ-FLAG с GST-NEMO определяли с помощью вестерн-блоттинга с использованием GST-NEMO в качестве контроля загрузки.(D, E) Необработанные клетки 264.7, предварительно обработанные контрольным носителем или SR12343 (150 мкМ) в течение 30 минут, стимулировали с использованием или без 10 нг / мл TNF-α (D) или 1 мкг / мл LPS (E) в течение 10 минут. Лизаты клеток анализировали на активность сигнального пути IKK / NF-κB, включая активацию комплекса IKK, IκBα и p65. GAPDH использовался в качестве контроля загрузки. (F) Необработанные клетки 264.7 инкубировали с контролем-носителем или SR12343 (100 мкМ) в течение 30 минут с последующей стимуляцией анти-LTβR или без него в течение 8 часов. Клеточные лизаты собирали и анализировали на активацию неканонической передачи сигналов NF-κB, обработку p100 на p52.(G, H) Анализ эффектов SR12343 (150 мкМ) на фосфорилирование JNK и p38MAPK в ответ на TNF-α (G) или LPS (H) с использованием того же клеточного лизата, который использовался на панелях D и E. Co -IP, коиммунопреципитация; GST, глутатион-S-трансфераза; IKK, IκB киназа; JNK, N-концевая киназа c-Jun; ЛПС, липополисахарид; LTβR, рецептор β лимфотоксина; MAPK, митоген-активированная протеинкиназа; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; NF-κB, ядерный фактор κB; TNF, фактор некроза опухоли; TRAF2, фактор 2, связанный с рецептором TNF.

https://doi.org/10.1371/journal.pbio.2004663.g005

Новые миметики NBD подавляют LPS-индуцированное острое воспаление легких in vivo

Для определения стабильности миметиков NBD in vivo их уровни измеряли в плазме мышей через 2 ч после внутрибрюшинного введения. инъекция 10 мг / кг каждого соединения. Концентрация SR12460 была очень высокой в ​​плазме (> 6,5 мкг / мл; 20 мкМ), тогда как уровни в мозге, мышцах, селезенке и печени были ниже. SR12343 и SR12454 имеют более низкие концентрации в плазме, при этом SR12343 показывает более высокий уровень в печени, а SR12454 показывает более высокие концентрации в мышцах и селезенке.Уровень SR11481 не определялся в плазме и тканях (рис. 6А). Поскольку SR12454 и SR12460 имеют сходные химические структуры, а SR11481 демонстрирует плохое воздействие in vivo, SR12460 и SR12343 были выбраны для дальнейшего анализа in vivo. Однако важно отметить, что SR12343 не был таким перорально активным, как SR123460 (S1B фиг.).

Рис. 6. Недавно идентифицированные миметики NBD подавляют LPS-индуцированное острое воспаление in vivo.

(A) Свойство биодоступности SR12460, SR12343, SR12454 и SR11481.Концентрации миметиков NBD определяли в плазме, головном мозге, мышцах, селезенке и печени через 2 часа после однократного внутрибрюшинного введения. введение 10 мг / кг препаратов; n = 3 на группу. (B) Показана модель индукции LPS-опосредованного острого воспаления и схема лечения миметиками NBD. Изображение мыши через http://www.clker.com/clipart-mice-blank.html (без авторских прав). (C) Миметики NBD подавляли LPS-индуцированное острое воспаление в печени и легких путем подавления экспрессии гена-мишени NF-κB. Носитель, SR12343, SR12460 и пептид 8K-NBD вводили в дозе 10 мг / кг за 30 мин до обработки LPS.Острое воспаление вызывали внутрибрюшинным введением. инъекция 10 мг / кг ЛПС. Легкие и печень собирали через 2–4 часа после инъекции, и мРНК экстрагировали для анализа qRT-PCR. (D, E) Вестерн-блоттинг был проведен для проверки экспрессии p-IκBα и COX-2 на уровне белка в тканях печени и легких. (F) Уровни IL-6 в сыворотке определяли с помощью ELISA. n = 3–8 в каждой группе. * P <0,05, ** P <0,01. Базовые данные можно найти в S1 Data. ЦОГ-2, циклооксигеназа 2; ИЛ-6, интерлейкин 6; я.п., внутрибрюшинно; ЛПС, липополисахарид; NBD, NEMO-связывающий домен; н.о., не обнаруживается; NEMO, существенный модулятор NF-κB; NF-κB, ядерный фактор κB; qRT-PCR, количественная полимеразная цепная реакция в реальном времени.

https://doi.org/10.1371/journal.pbio.2004663.g006

Чтобы определить их ингибирующие эффекты NF-κB in vivo, SR12343 и SR12460 были протестированы на острой модели системной эндотоксемии, вызванной LPS. Мышей C57BL / 6J предварительно обрабатывали контрольным носителем, пептидом 8K-NBD или миметиками NBD в дозе 10 мг / кг в течение 30 мин с последующей индукцией LPS в дозе 10 мг / кг (фиг. 6B).Легкие и печень собирали через 2–4 часа после обработки для анализа генов-мишеней NF-κB с помощью qRT-PCR. SR12343 был способен значительно ингибировать транскрипционную активность NF-κB в легких, что продемонстрировано ингибированием iNOS, IκBα, COX-2 и IL-6, в то время как экспрессия TNF-α не изменилась (рис. 6C). Эффекты соединений по ингибированию NF-κB были менее эффективными в печени по сравнению с легкими, что продемонстрировано значительным ингибированием только экспрессии COX-2 (фиг. 6C). Несмотря на более низкие концентрации SR12343 в плазме и тканях по сравнению с SR12460, его ингибирование NF-κB / IKK в печени и легких было больше, чем у SR12460 (рис. 6C).Точно так же неотложное лечение SR12343 также влияло на индуцированную LPS экспрессию генов-мишеней NF-κB на уровне белка. Степень фосфорилирования IκBα и уровни ЦОГ-2 были снижены в тканях легких и печени, обработанных SR12343 (рис. 6D и 6E). Уровни IL-6 в сыворотке, обнаруженные с помощью ELISA, значительно увеличились после индукции LPS и были снижены при неотложном лечении SR12343 (фиг. 6F). Эти результаты согласуются с нашим анализом RT-PCR, показанным на фиг. 6C. Однако никаких существенных различий в гистопатологии легких не наблюдалось.Наконец, наблюдалось небольшое снижение количества лейкоцитов и нейтрофилов в группе, получавшей SR12343 (Таблица 2). Взятые вместе, результаты демонстрируют, что SR12343 и SR12460 эффективны при ослаблении LPS-индуцированного острого воспаления легких путем подавления экспрессии гена-мишени NF-κB.

Новые миметики NBD уменьшают некроз и мышечную дегенерацию у мышей MDX

Поскольку SR12343 и SR12460 снижали LPS-индуцированную активацию NF-κB in vivo, они были дополнительно протестированы на мышах mdx , мышиной модели DMD, у которой NF-κB активирован хронически [28].Мыши Mdx нормально развиваются при рождении и претерпевают массивный мионекроз, начиная с 3 недель. Лечение мышей mdx ингибиторами IKK / NF-κB эффективно снижает воспаление, блокирует некроз и увеличивает регенерацию мышц. Первоначально влияние экстренного лечения SR12343 на активность связывания ДНК NF-κB в передней большеберцовой мышце (TA) у 9-недельных мышей mdx исследовали с помощью EMSA. Обработка однократной инъекцией 30 мг / кг SR12343 приводила к снижению связывания ДНК NF-κB через 2 часа после инъекции (S4C фиг.).Впоследствии мышей Mdx хронически лечили носителем, SR12343 (30 мг / кг), SR12460 (30 мг / кг) или 8K-NBD (10 мг / кг), начиная с 21 дня, 3 раза в неделю в течение 4 недель. , аналогично режиму дозирования, используемому с пептидом NBD (рис. 7A) [7]. У длительно леченных мышей mdx не наблюдалось значительной потери веса (фиг. S3A). Кроме того, не наблюдалось повышения уровней аспартатаминотрансферазы (AST), аланинаминотрансферазы (ALT) или щелочной фосфатазы (ALP) у мышей mdx , подвергавшихся хроническому лечению (фиг. S3B), что позволяет предположить, что лечение SR12343 и SR12460 не имело явного эффекта. печеночная токсичность.

Рис. 7. Миметики NBD улучшают мышечную патологию и силу хвата у мышей MDX.

(A) Показана схема лечения миметиками NBD у мышей mdx. (B) Окрашивание гематоксилином-эозином мышцы ТА у 7-недельных мышей MDX, получавших лечение или не получавших лечения. Изображения были получены при увеличении 20 ×. Репрезентативные изображения были показаны для каждой группы лечения. (C) Количественное определение процента площади, демонстрирующей некроз или инфильтрацию, с использованием изображения J. (D) qRT-PCR анализ eMyHC и Pax7 в мышце TA.(E) ТА-мышца от 7-недельных мышей MDX, подвергнутых лечению или не получавших лечения, была окрашена ламинином с помощью ИГХ, чтобы очертить миофибриллы. Слева были показаны общие изображения ТА-мышцы, а с правой стороны - изображения вставной панели. (F) Количественное определение минимального диаметра Ферета в миофибриллах с центральным и нецентральным ядром. (G) Сила передних конечностей, определяемая тестом на силу захвата. Пятинедельных (2 недели после лечения) и 7-недельных (4 недели после лечения) мышей mdx, подвергнутых лечению или не получавших лечения, тестировали на силу захвата передними конечностями.Было проведено пять последовательных тестов, и сила была нормализована по массе тела. Данные представлены как среднее +/- SEM. Используемые дозировки следующие: SR12343 (30 мг / кг), SR12460 (30 мг / кг) и пептид 8K-NBD (10 мг / кг). n = 6–7 в каждой группе. * P <0,05, ** P <0,01. Базовые данные можно найти в S1 Data. eMyHC, тяжелая цепь эмбрионального миозина; ИГХ, иммуногистохимия; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; Pax7, парный бокс-белок 7; qRT-PCR, количественная полимеразная цепная реакция в реальном времени; TA, tibialis anterior.

https://doi.org/10.1371/journal.pbio.2004663.g007

Чтобы определить, улучшают ли SR12343 и SR12460 мышечную патологию, мышцу ТА окрашивали гематоксилин-эозином для оценки воспалительной инфильтрации, некроза, центрального зародышеобразования и фиброза. Мышцы ТА, обработанные носителем, демонстрировали обширную инфильтрацию и некроз, что отражалось скоплениями воспалительных клеток, дезорганизованными миофибриллами и неравномерным окрашиванием с ограниченной регенерацией мышц. В соответствии с предыдущими исследованиями, лечение пептидом 8K-NBD уменьшало инфильтрацию и некроз воспалительных клеток, как показано на фиг. 7B и 7C, при этом не влияя существенно на процент централизованных миоядер (фиг. S4A) [29, 30].Лечение SR12343 привело к наиболее значительному патологическому улучшению, представленному ограниченной инфильтрацией и усиленной реконструкцией мышц (рис. 7B и 7C и рис. S4B). Точно так же лечение SR12460 улучшило мышечную патологию, хотя и не так эффективно, как SR12343. Кроме того, было проведено окрашивание трихромом по Массону для дальнейшего измерения мышечного фиброза. Хроническое лечение SR12343 уменьшало мышечный фиброз (синий) в диафрагме и мышечных тканях TA по сравнению с контрольной группой (рис. 8A и 8B).Для дальнейшего количественного определения степени воспаления в mdx мышечных тканях диафрагма и мышца TA были иммуноокрашены на кластер дифференцировки 68 (CD68), маркер макрофагов. Обработка SR12343 уменьшала количество клеток CD68 + почти на 50% на миофибриллу как в диафрагме, так и в тканях ТА (рис. 8A и 8B). Примечательно, что существует более высокий уровень инфильтрации макрофагами в диафрагме по сравнению с ТА, о чем свидетельствует большее количество клеток CD68 + на миофибрилло.Этот результат согласуется с окрашиванием трихромом, при котором диафрагма проявляла более тяжелый мышечный фиброз по сравнению с ТА. Более того, анализ qRT-PCR выявил значительное улучшение регенерации миофибрилл в ТА-мышце, обработанной SR12343, по сравнению с контрольными носителями, о чем свидетельствует повышенная экспрессия тяжелой цепи эмбрионального миозина (eMyHC), а также парного бокс-белка 7 (Pax7), маркера скелетной мышечные сателлитные клетки (рис. 7D). SR12460 и пептид 8K-NBD также увеличивали экспрессию eMyHC, но в меньшей степени, чем SR12343.Чтобы оценить средний размер волокна непредвзято, ТА-мышцу окрашивали ламинином, чтобы очертить миофибриллы, и определяли диаметр всех миоцитов по Ферету на всем срезе мышцы. Размер волокон центрально и нецентрально ядерных миофибрилл был меньше у мышей, получавших SR12343 и пептид 8K-NBD, что свидетельствует об активной реконструкции миофибрилл во время регенеративной фазы (рис. 7E и 7F).

Рис. 8. Хроническое лечение миметиками NBD снижает мышечный фиброз за счет уменьшения инфильтрации макрофагов у мышей mdx .

(A, B) Окрашивание трихромом и CD68 (A) диафрагмы и (B) TA-мышцы у 7-недельных мышей mdx, получавших или не получавших SR12343. CD68 (красный): маркер тканевого макрофага; утрофин (зеленый): краситель для миофибрилл; DAPI (синий): ядра. Изображения трихрома были получены при увеличении 4 × для TA и 10 × для диафрагмы. Изображения IHC были получены при 10 × для TA и 20 × для диафрагмы. Репрезентативные изображения были показаны для каждой группы лечения. Данные представлены как среднее +/- SEM. * P <0,05; ** P <0.01; *** P <0,001. Базовые данные можно найти в S1 Data. CD68, кластер дифференцировки 68; ИГХ, иммуногистохимия; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; TA, tibialis anterior.

https://doi.org/10.1371/journal.pbio.2004663.g008

Чтобы определить, улучшают ли миметики NBD мышечную силу, через 2 и 4 недели после лечения измеряли силу захвата для оценки силы передних конечностей (рис. 7G). По сравнению с группой носителя SR12343 значительно улучшил силу передних конечностей после 2 недель лечения, что указывает на быстрое восстановление мышц.Все группы лечения по сравнению с контролем показали значительно усиление силы передних конечностей через 4 недели после лечения (рис. 7G). В совокупности два основных соединения - SR12460 и, в частности, SR12343 - заметно улучшили мышечную функцию и мышечную патологию у мышей mdx .

Обсуждение

Пептид NBD, полученный из NBD в IKKβ, обладает высокими терапевтическими свойствами на многочисленных моделях воспалительных и дегенеративных заболеваний у мышей и собак [6–9, 12, 13, 17, 18]. Фактически, пептид NBD гораздо более эффективен в качестве терапевтического средства, чем низкомолекулярные ингибиторы активного центра киназы IKKβ.Однако синтез пептида NBD в больших масштабах может быть проблематичным и чрезвычайно дорогостоящим, что препятствует его клиническому применению для людей, которым требуется большая доза по сравнению с грызунами и собаками. Кроме того, пептид NBD не является активным при пероральном введении. Таким образом, разработка низкомолекулярных миметиков NBD представляет собой значительный прогресс в направлении клинической трансляции этой установленной молекулярной мишени. Здесь мы идентифицировали и оптимизировали несколько новых миметиков NBD, которые избирательно ингибировали активацию IKK / NF-κB.Два основных соединения, SR12343 и SR12460, ингибировали как TNF-α-, так и LPS-индуцированную активацию NF-κB более эффективно и в более низкой концентрации, чем пептид NBD, как в клетках HEK293, так и в Raw 264.7.

Для идентификации миметиков NBD была использована кампания компьютерного скрининга, основанная на фармакофорной модели [21]. Эта основанная на структуре модель фармакофора была успешно использована для идентификации низкомолекулярных ингибиторов p53-модулятора апоптоза (PUMA), нацеленных на его связывание с членами семейства B-клеточной лимфомы 2 (Bcl-2) через домен Bh4 [31] .Исследование кристаллической структуры взаимодействия NBD-IKKβ продемонстрировало, что аминокислотные остатки W741, W739 и F734 являются важными гидрофобными мотивами IKKβ для динамического взаимодействия с NEMO [21]. Кроме того, всесторонний анализ горячих точек энергии связывания выявил 3 области, критические для интерфейса межбелкового взаимодействия между NEMO и IKKβ: задокументированные области NBD (W739, W741 и L742) и 2 новые области горячих точек с центром на остатках IKKβ L708 / V709 и L719 / I723 [32]. Соответственно, мутантный 11-мерный пептид NBD (735-745) - с заменами аргинина на W741 и W739 - был неспособен связываться с NEMO [27].Более длинный пептид, производный от IKKβ (701-746), содержащий все 3 остатка и домена, проявлял самое сильное сродство к NEMO, с IC 50 около 10 нМ, по сравнению с традиционным 11-мерным пептидом NBD, который был менее активным, с IC 50 около 100 мкМ [21, 32–34].

Чтобы идентифицировать миметики NBD с большей биологической активностью, F734, не содержащийся в 11-аминокислотном пептиде NBD, был включен в нашу фармакофорную модель и скрининг in silico. Новые идентифицированные и оптимизированные миметики NBD были способны ингибировать активность NF-κB дозозависимым образом (IC 50 приблизительно 10-40 мкМ) и были более эффективными, чем 11-мерный пептид NBD [21, 33].Эти результаты согласуются с другими результатами, предполагающими, что, хотя IKKβ 737–742 является основным компонентом, необходимым для образования комплекса IKK, более крупная область, охватывающая IKKβ 701–746 , увеличивает аффинность связывания между IKKβ и NEMO [32, 34, 35].

Идентифицированный и оптимизированный миметик NBD SR12343 был способен диссоциировать комплексы NEMO / IKKβ как in vitro, так и in vivo (рис. 5), что согласуется с предыдущими сообщениями о том, что пептид NBD блокирует ассоциацию предварительно сформированных комплексов IKK в неактивном состоянии [27, 33] .Кроме того, хотя сообщалось, что пептид NBD блокирует взаимодействие NEMO с IKKα и снижает индуцированную IL-1 IKKα-зависимую активацию NF-κB в эмбриональных фибробластах мыши (MEF) [27, 36], SR12343 нарушает связывание NEMO а IKKα гораздо менее эффективен. Эта специфичность для NEMO / IKKβ может быть связана с тем, что в IKKα в положении 734 присутствует метионин вместо фенилаланина, в то время как F734 вместе с W739 и W741 был включен для создания модели фармакофоров. Наши результаты также продемонстрировали, что SR12343 подавлял TNF-α- и LPS-индуцированную активность NF-κB путем ингибирования фосфорилирования IKK, IκBα и p65, не влияя при этом на передачу сигналов JNK и p38MAPK (рис. 5).По-видимому, SR12343 имеет более существенное ингибирование LPS-индуцированной активации NF-κB по сравнению со стимуляцией TNF-α. Возможно, это связано с более сильной вторичной активацией NF-κB при стимуляции TNF-α за счет активации экспрессии множества провоспалительных факторов. Передача сигналов MAPK может стимулироваться подобными провоспалительными факторами, такими как TNF-α и LPS, увеличивая экспрессию провоспалительных генов через AP-1 и NFAT [1, 37]. Кроме того, SR12343 не влияет на передачу сигналов неканонического пути NF-κB через LTβR (рис. 5F).

Миметики

NBD ингибировали уникальную подгруппу генов-мишеней по сравнению с ингибиторами киназы IKK, особенно iNOS, как in vitro, так и in vivo. Экспрессия iNOS в ответ на LPS может быть снижена в 6 раз в клетках Raw 264.7 и на 50% как в легких, так и в печени путем обработки мышей миметиками NBD. iNOS участвует в метаболизме аргинина, что приводит к выработке цитруллина и оксида азота (NO), последний из которых, действуя как свободный радикал, способствует цитотоксичности и повреждению тканей [38].У мышей iNOS-null mdx значительно снизился цитолиз макрофагов и уменьшилось повреждение миофибрилл как в острой, некротической фазе (4 недели), так и в фазе регенерации (6–12 недель), что указывает на критическую роль NO-опосредованного мионекроза в патологии . mdx мышей [38]. Мы продемонстрировали уменьшение некроза, фиброза и воспалительной инфильтрации как в диафрагме, так и в мышцах ТА у обработанных мышей mdx , в частности, мышей mdx , получавших лечение SR12343, по сравнению с контрольной группой.Также, как и у мышей mdx , получавших пептид NBD, обработка миметиками NBD, в частности SR12343, приводила к усилению миогенеза, о чем свидетельствует более высокая экспрессия eMyHC и Pax7 и меньший размер центрально-ядерных волокон (рис. 6). Это согласуется с наблюдаемой способностью NF-κB регулировать дифференцировку клеток посредством регуляции транскрипции циклина D1 [39]. Взятые вместе, наши результаты показывают, что низкомолекулярные миметики NBD могут одновременно ингибировать провоспалительные реакции, снижать цитотоксичность макрофагов и улучшать дегенерацию мышц с даже большей эффективностью, чем пептид NBD.На основании клинического химического анализа сыворотки явных признаков токсического действия на печень у мышей, подвергшихся хроническому лечению, не наблюдалось.

Ранее мы продемонстрировали, что хроническое лечение модели ускоренного старения на мышах Ercc1 - / Δ пептидом NBD задерживало появление многочисленных возрастных симптомов, улучшало патологию и уменьшало клеточное старение. Как и в случае с пептидом NBD, предварительные эксперименты показывают, что хроническое лечение мышей Ercc1 - / Δ с помощью SR12343 привело к увеличению продолжительности жизни.Таким образом, эти новые миметики NBD могут использоваться не только для лечения воспалительных и дегенеративных заболеваний, но и для лечения старения.

В совокупности наши данные демонстрируют, что новые низкомолекулярные миметики NBD являются мощными и высокоселективными ингибиторами IKK, которые действуют, нарушая ассоциацию комплексов IKK. Они проявляют значительный ингибирующий эффект на активацию NF-κB на модели LPS-индуцированного острого повреждения легких (ALI) и мышиной модели DMD ( mdx мышей), что позволяет предположить потенциал миметиков NBD стать отдельным классом анти- противовоспалительные препараты.Взятые вместе, миметики NBD могут иметь терапевтическую ценность для лечения хронических воспалительных заболеваний и рака в будущем.

Методы

Заявление об этике

Исследования на животных были рассмотрены и одобрены Комитетом по уходу и использованию животных Скриппса Флориды (протоколы № 15–017 и 15–020) и соответствовали Руководству HHS США по уходу и использованию лабораторных животных. Повседневный уход за животными осуществлялся Научно-исследовательским центром животных Флориды Скриппса.У Скриппса Флорида есть Гарантия благополучия животных, находящаяся в досье в Управлении защиты лабораторных животных (OLAW), Национальных институтов здравоохранения. Номер гарантии - # A4460-01, действует с 30 января 2009 г. Регистрация Scripps Florida в соответствии с правилами USDA - это сертификат 93-R0015, действующий 5 декабря 2005 г. Ассоциация и аккредитация Международной организации по уходу за лабораторными животными (AAALAC) предоставила Scripps Florida полную аккредитацию. 25 июня 2008 г., а продолжение было присуждено 9 ноября 2011 г.Мышей умерщвляли в возрасте 7 недель путем вдыхания диоксида углерода.

Клетки и мыши

Клетки

HEK293 и MEF выращивали в среде Игла, модифицированной Дульбекко (с 4,5 г / л глюкозы и L-глутамина), с добавлением 10% фетальной бычьей сыворотки, пенициллина и стрептомицина. Необработанные клетки 264,7 культивировали в среде RPMI-1640, содержащей 10% инактивированной нагреванием фетальной бычьей сыворотки, пенициллин и стрептомицин. C57BL / 10ScSn- Dmd mdx / J и самки мышей C57BL / 6 были приобретены в лаборатории Джексона.Мышей содержали в помещениях для животных Scripps Florida при постоянной температуре и влажности. Протоколы для животных, использованные в этом исследовании, были одобрены Комитетом по уходу и использованию животных Скриппса Флориды. Мышам mdx соответствующего пола трехнедельного возраста вводили дозы SR12343 (30 мг / кг), SR12460 (30 мг / кг), пептид 8K-NBD (10 мг / кг) или носитель путем внутрибрюшинного введения. инъекции 3 раза в неделю в течение 4 недель. Мышей умерщвляли в возрасте 7 недель путем вдыхания двуокиси углерода и собирали ТА-мышцы для гистологического анализа.

Пептид 8K-NBD и малые молекулы

Пептид

8K-NBD (KKKKKKKGGTALDWSWLQTE) был синтезирован в центре пептидного ядра Университета Питтсбурга. Для i.p. инъекции пептид растворяли в 10% ДМСО в PBS. Миметики NBD были приготовлены в соотношении 10:10:80 ДМСО: Твин 80: вода для введения in vivo. Небольшие молекулы ЦИНК были приобретены у Enamine. Все исходные растворы для экспериментов in vitro готовили в ДМСО при 40 мкМ.

Острое воспаление легких, вызванное ЛПС

LPS (штамм O111: B4) получали в PBS в сублетальной дозе 10 мг / кг.Самкам мышей WT в возрасте 8-10 недель (20-30 г) вводили внутрибрюшинную дозу. инъекция носителя, пептида NBD (10 мг / кг) или малых молекул (10 мг / кг) в течение 30 мин с последующим внутрибрюшинным введением. инъекция физиологического раствора (1 мл / кг) или ЛПС (10 мг / кг). Мышей умерщвляли через 2-4 часа после обработки, и ткани легких и печени собирали для дальнейшего анализа.

Анализ функциональной силы захвата

У обработанных или необработанных мышей mdx в возрасте семи недель измеряли силу захвата передними конечностями с помощью цифрового измерителя силы захвата в паре с металлической сеткой (Bioseb, Vitrolles, Франция).Мышам позволяли крепко держаться за металлическую сетку, и показания получали, осторожно оттягивая хвост назад до освобождения. Было проведено пять последовательных измерений и рассчитана средняя сила.

Анализ люциферазы светлячков

Клетки

HEK293, стабильно трансфицированные люциферазной репортерной плазмидой, управляемой NF-κB, высевали в 96-луночные планшеты в трех повторностях и предварительно обрабатывали ДМСО или различными небольшими молекулами при указанной концентрации в течение 30 минут с последующей стимуляцией 10 нг / мл TNF- α в течение 3 ч [25].Клетки один раз промывали PBS и собирали в буфере для пассивного лизиса (Promega, Madison, WI). Анализ люциферазы (Promega) выполняли с использованием люминометра в соответствии с инструкциями производителя.

Двойной репортерный анализ люциферазы

Клетки HEK293, выращенные в 10-сантиметровых планшетах, котрансфицировали с помощью корепортера плазмиды Renilla, управляемой SV40 (Promega), и плазмиды люциферазы светлячка, управляемой NF-κB в соотношении 1: 3, с липофектамином 2000 (Invitrogen, Карлсбад, Калифорния). .Кратковременно трансфицированные клетки HEK293 выращивали и обрабатывали, как описано выше, и подвергали двойному люциферазному репортерному анализу в соответствии с инструкциями производителя. Вкратце, активность люциферазы светлячка NF-κB и люциферазы Renilla определяли последовательно. Относительную активность люциферазы рассчитывали путем нормализации люциферазы NF-κB к активности люциферазы Renilla.

Анализ МТТ

клеток HEK293 выращивали в 96-луночном планшете из расчета 3 × 10 4 клеток / лунку в трех экземплярах и обрабатывали ДМСО или перечисленными небольшими молекулами при указанных концентрациях в течение 24 часов.Выживание клеток определяли добавлением 20 мкл 5 мг / мл МТТ (тиазолиловый синий тетразолий бромид) в каждую лунку с последующей инкубацией при 37 ° C в течение 3 часов. Среду удаляли, и пурпурный формазан растворяли в 100 мкл ДМСО. Поглощение измеряли при 590 нм на считывающем устройстве для микропланшетов (PerkinElmer, Waltham, MA). Жизнеспособность клеток рассчитывали путем нормализации значений к необработанным контролям.

Вестерн-блоттинг

Лизат клеток был приготовлен в буфере RIPA (20 мМ Трис-HCl [pH 7,5], 150 мМ NaCl, 1 мМ NaCl 2 ЭДТА, 1 мМ EGTA, 1% NP-40, 1% дезоксихолат натрия, 2.5 мМ пирофосфат натрия, 1 мМ бета-глицерофосфат, 1 мМ Na 3 VO 4 и 1 мкг / мл лейпептина) с добавлением коктейлей 1X ингибиторов протеазы (MilliporeSigma, Сент-Луис, Миссури) и ингибиторов фосфатазы 1X Halt коктейль (ThermoFisher, Waltham, MA). Концентрации белка определяли с помощью анализа белка Лоури, и 30 мкг белка разделяли с помощью гелей MINI-PROTEAN TGX 4–15% SDS-PAGE. Блоты инкубировали с первичными антителами в течение ночи при 4 ° C и вторичными антителами при комнатной температуре в течение 1 часа.Используемые реагенты и антитела: рекомбинантный мышиный TNF-α (10 нг / мл; PeproTech # 315-01A), LPS из Escherichia coli , серотип O111: B4 (1 мкг / мл; Enzo # ALX-581-012. -L001), рекомбинантный мышиный IL-1α (0,5 нг / мл; PeproTech # 211-11A), антитело против LTβR (1: 300; Abcam # ab65089), анти-p-IκBα (1: 1000; CST), IκBα (C-21) антитело (1: 1000; # sc-371), антитело p-IKKα / β (Ser176 / 180) (1: 500; CST # 2697), антитело IKKα (1: 1000; CST # 2682), анти-IKKβ (1: 1000; CST # 8943), антитело p-p65 (Ser536) (93h2) (1: 2000; CST # 3033), антитело p65 (D14E12) (1: 5000; CST # 8242), p100 / Антитело p52 (1: 500; CST # 4882), антитело p-TAK1 (Thr184 / 187) (1: 500; CST # 4508) и анти-GAPDH (1: 5000; CST # 5174).

Совместная иммунопреципитация эндогенного IKKβ и NEMO

Необработанные клетки 264,7 высевали из расчета 1 × 10 6 клеток / лунку в 6-луночные планшеты или 6 × 10 6 клеток / 10 см планшет и предварительно обрабатывали носителем, низкомолекулярными ингибиторами или пептидом NBD в течение 30 мин. Лизаты клеток собирали в буфере для лизиса NP-40 с добавлением коктейлей 1Х ингибиторов протеазы (Sigma). Белки подвергали иммунопреципитации, инкубируя 150 мкг лизатов (1 мкг / мкл) с 10 мкл конъюгированного с агарозой антитела NEMO (FL-419) (sc-8330 AC, Санта-Крус, Даллас, Техас) на роторном шейкере при 4 ° C. за 4 ч.В качестве альтернативы мы инкубировали 500 мкг белковых лизатов с 10-15 мкл антитела NEMO (FL-419) (Santa Cruz) в течение 2 часов при 4 ° C, затем добавляли 50 мкл Dynabeads (ThermoFisher) к комплексу Ab-Ag и инкубировали на ротатор на 1 час при 4 ° C. Комплекс Ag-Ab-Bead затем промывали буфером NP-40 3 раза и один раз PBS. Затем белок денатурировали в буфере для образцов SDS и разделяли с помощью MINI-PROTEAN TGX 4% –15% SDS-PAGE. Десять процентов клеточных лизатов были исследованы в качестве входных контролей на коиммунопреципитацию. Используются следующие антитела: анти-IKKβ (1: 1000; CST # 8943), анти-NEMO (1: 1000; CST # 2685), антитело TRAF2 (C192) (1: 1000; CST # 4724), антитело IKKα ( 1: 1000; CST # 2682) и антитело IκBα (C-21) (1: 1000; # sc-371).

Анализ связывания IKKβ-NEMO

Рекомбинантный полноразмерный NEMO, помеченный GST на N-конце (SignalChem, Ричмонд, Британская Колумбия, Канада) при 15 нМ, предварительно инкубировали с ингибиторами в течение 15 мин при комнатной температуре с последующей инкубацией с 15 нМ рекомбинантного полноразмерного IKKβ, меченного с FLAG на С-конце (Origene) в течение 30 мин при 30 ° C. Буфер TNT (50 нМ Трис [pH 7,5], 200 мМ NaCl, 1% Triton X-100 и 1 мМ DTT [pH 7,4]) использовали в качестве связывающего и промывочного буфера. Затем продукты связывания инкубировали с 25 мкл гранул глутатион-агарозы (ThermoFisher) в течение 1 ч при 4 ° C на ротаторе.Конечные продукты тщательно промывали буфером TNT 4 раза перед добавлением буфера для образцов. Затем образцы разделяли с помощью гелей SDS-PAGE. Используются следующие антитела: антитело GST (B-14), HRP (1: 3000; # sc-138 HRP) и моноклональное антитело против FLAG M2 (1: 2000; Sigma-Aldrich, F3165).

EMSA

Цитоплазматические и ядерные фракции экстрагировали с использованием реактивов для ядерной и цитоплазматической экстракции NE-PER (ThermoFisher) в соответствии с инструкциями производителя. Анализ сдвига геля проводили по ранее описанной методике [39].Вкратце, 5 мкг ядерного экстракта инкубировали со сдвигающим связывающим буфером 5X в течение 10 мин при комнатной температуре (Promega). Затем зонд с радиоактивной меткой альфа-32P-дезоксицитодинтрифосфата, содержащий согласованную последовательность связывания NF-κB, в концентрации 200000 имп / мин / мкл, добавляли к реакционной смеси и инкубировали в течение 20 минут при комнатной температуре (MP Biomedicals, Santa Ana , Калифорния). Продукт реакции отделяли на 6% неденатурирующем полиакриламидном геле перед авторадиографической визуализацией. Олигонуклеотидные последовательности являются следующими: матричный олиго NF-κB, 5'-CAGGGCTGGGGATTCCCCATCTCCACAGTTTCACTTC-3 '; NF-κB олиго отжига, 5'-GAAGTGAAACTGTGG-3 '(Integrated DNA Technologies, Coralville, IA).

qRT-PCR

Быстро замороженные ткани сохраняли в растворе для стабилизации РНК RNAlater (ThermoFisher). Тотальную РНК экстрагировали из клеток или тканей с использованием реагента ТРИЗОЛ (Life Technologies), и 1500 нг мРНК подвергали синтезу кДНК с использованием набора для синтеза кДНК SuperScript VILO. qRT-PCR выполняли в системе StepOnePlus Real-Time PCR с использованием Platinum SYBR Green qPCR SuperMix-UDG (ThermoFisher). Экспрессию целевого гена рассчитывали с использованием сравнительного метода C T (ΔΔC T ) путем нормализации до гена внутреннего контроля Actb (β-актин).Использованы следующие праймеры: Ptgs2 (COX-2) вперед: ACTCATAGGAGAGACTATCAAG; Ptgs2 (COX-2) реверс: GAGTGTGTTGAATTCAGAGG; Nfkbia (IκBα) нападающий: CAGAATTCACAGAGGATGAG; Nfkbia (IκBα) реверс: CATTCTTTTTGCCACTTTCC; Il1b (IL-1β) вперед: GGATGATGATGATAACCTGC; Il1b (IL-1β), обратный: CATGGAGAATATCACTTGTTGG; №2 (iNOS) вперед: TGAAATCCCTCCTGATCTTG; №2 (iNOS) реверс: CCATGTACCAACCATTGAAG; Tnf (TNF) вперед: CTATGTCTCAGCCTCTTCTC; Tnf (TNF) обратный: CATTTGGGAACTTCTCATCC; Ил6 (Ил-6) вперед: AAGAAATGATGGATGCTACC; Il6 (IL-6) реверс: GAGTTTCTGTATCTCTCTGAAG. Actb (β-актин) вперед: GATGTATGAAGGCTTTGGTC; Actb (β-актин) обратный: TGTGCACTTTTATTGGTCTC.

Иммуноферментный анализ

Клетки

Raw 264.7 выращивали в 96-луночных планшетах и ​​предварительно обрабатывали носителем, IKKi VII (2 мкМ) и небольшими молекулами (в указанной концентрации) в течение 1 ч с последующей стимуляцией 1 мкг / мл LPS. Супернатант собирали через 24 часа для анализа ELISA. Концентрацию IL-6 измеряли с использованием набора ELISA для мышиных IL-6 (BD) в соответствии с инструкциями производителя.

Уровни TNF-α и IL-6 в сыворотке мышей определяли с использованием набора ELISA для мышиного TNF-α (BD Biosciences, Франклин Лейкс, штат Нью-Джерси) и набора ELISA для мышиного IL-6 (BD Biosciences) в соответствии со спецификациями производителя. Оптическую плотность определяли при 450 нм с использованием планшет-ридера Spectramax i3 (Molecular Devices, Сан-Хосе, Калифорния). Все стандарты и образцы были измерены в двух экземплярах.

Окрашивание гематоксилином – эозином

Ткани, зафиксированные в 10% нейтральном забуференном формалине (NBF) в течение ночи, заливали парафином.На микротоме делали срезы ткани размером 5 мкм. Окрашивание гематоксилин-эозином проводили по стандартному протоколу [30].

Трихромное пятно по Массону

Окрашивание трихромом по Массону проводили с помощью набора для окрашивания трихромом, модифицированного Массоном IMEB (IMEB, Сан-Маркос, Калифорния), в соответствии с инструкциями производителя, который окрашивает коллаген в синий цвет, мышечные волокна в красный цвет и ядра в черный цвет. Вкратце, замороженные срезы ткани фиксировали 10% формалином и затем инкубировали в растворе йода, растворе гематоксилина, растворе фушина алой кислоты Биберта, растворе фосфомолибденовой кислоты и анилиновом синем растворе.Затем предметные стекла промывали, обезвоживали и устанавливали для визуализации.

Иммуногистохимия и количественное определение мышц

Для точного количественного определения среднего размера волокна TA-мышцу окрашивали ламинином, чтобы очертить миофибриллы. С помощью программного обеспечения для анализа NIS Elements (Nikon, Melville, NY) сигнал ламинина был скорректирован на фон и подвергся гомогенизации сигнала и усилению структуры с использованием алгоритма локального контраста и сглаживания на основе ядра. Мышечные волокна были определены путем применения однородной бинарной маски к отрицательному пространству изображения ламинина, а затем сегментированы с использованием логического оператора, чтобы изолировать только отрицательное пространство, перекрывающееся с общей площадью ткани, присутствующей на изображении.Ядра, определенные с помощью маркировки Hoechst (Sigma bisBenzimide H 33258), были определены с использованием единой бинарной маски, а сегментация была выполнена с помощью алгоритма водораздела. Волокна с центральными ядрами определялись путем разрушения бинарной маски мышечных волокон так, чтобы присутствовала только центральная часть каждого волокна. Булевский оператор использовался, чтобы определить, перекрываются ли эродированные волокна с маской, связанной с ядром, и если да, то они считались централизованными. Затем, используя исходную маску мышечных волокон, были измерены диаметры Фере центрально зародышевых и нецентрально зародышевых волокон.

Замороженные срезы ткани фиксировали 4% параформальдегидом в течение 1 ч и инкубировали с 1% BSA для блокирования. Первичные антитела CD68 (Abcam, Cambridge, MA) и атрофин (Santa Cruz) применяли в соотношении 1: 200 в течение 2 часов. Затем наносили вторичные антитела Alexa Fluor 594 и Alexa Fluor 488 в соотношении 1: 400 в течение 1 часа. Раствор DAPI (1; 1000) использовали для окрашивания ядра клетки. Все процессы проводились при комнатной температуре.

Гематологический и биохимический анализ сыворотки крови

Девять мышей (самцы; C57BL / 6, 9–13 недель) случайным образом были разделены на 3 группы по 3 мыши в каждой группе.Мышам вводили внутрибрюшинно. с носителем (ДМСО: Tween80: H 2 O, 10:10:80) или низкомолекулярным SR12343 (30 мг / кг) в течение 30 мин, а затем вводили внутрибрюшинно. с физиологическим раствором (1 мл / кг) или LPS (10 мг / кг в физиологическом растворе). Через 2 часа мышей умерщвляли удушением CO 2 перед забором крови посредством сердечной пункции. Кровь от каждой мыши помещали в 2 пробирки для забора крови с коагулянтом или антикоагулянтом гепарином (примерно по 0,6 мл каждая). Образцы в пробирках, покрытых антикоагулянтом гепарином, несколько раз перемешивали вручную и помещали на влажный лед для гематологического анализа с использованием автоматического гематологического анализатора (Hemavet 950FS; Drew Scientific, Miami Lakes, FL).Образцам в пробирках, не содержащих антикоагулянта, давали возможность свернуться перед центрифугированием и отправкой на биохимический анализ сыворотки с использованием анализатора VetScan VS2 с ротором реагентов для комплексного диагностического профиля (Abaxis, Union City, CA). Активности АЛТ, АСТ и АЛТ в сыворотке определяли колориметрическим ферментативным методом с использованием клинического химического анализатора Cobas c311 (Roche Diagnostics, Risch-Rotkreuz, Швейцария) в соответствии с инструкциями производителя.

Исследование фармакокинетики

Фармакокинетический профиль миметиков NBD был определен на самцах мышей C57BL / 6J ( n = 3).Препараты готовили в смеси ДМСО: Твин 80: вода 10:10:80 и вводили внутрибрюшинно. инъекция в конечной дозе 10 мг / кг. Кровь, мозг, мышцы, селезенка и печень собирали через 2 часа после обработки и анализировали масс-спектрометрией, следуя ранее описанному протоколу [40].

Фармакофор, модель поколения

Рентгеновская структура комплекса NEMO / IKKβ, полученная из PDB (ID 3BRV), была использована для создания модели фармакофора на основе структуры [21]. Трехмерная (3D) модель фармакофора была создана с помощью LigandScout [22, 23] и основана на взаимодействиях, которые определяют межбелковое взаимодействие, таких как гидрофобные взаимодействия, водородные связи и электростатические взаимодействия.Программа LigandScout определяет особенности, которые учитывают химическую функциональность, но не учитывают строгую структурную топологию или определенные функциональные группы. В результате с помощью скрининга базы данных могут быть идентифицированы совершенно новые потенциальные фармаконы. Более того, для повышения селективности модель LigandScout включает пространственную информацию относительно областей, недоступных для любого потенциального лиганда, тем самым отражая возможные стерические ограничения. В частности, сферы исключенного объема, помещенные в положения, которые стерически не разрешены, автоматически добавляются к сгенерированной фармакофорной модели.Таким образом, основанная на структуре модель фармакофора содержит фармакофорные элементы кандидатов в лиганды в ответ на среду активного сайта белка [41].

Поиск по сходству

Распознавание малых молекул белками в значительной степени опосредовано комплементарностью поверхности молекул. Подходы к разработке лекарств на основе структуры используют это как основополагающий руководящий принцип; то есть близкородственные молекулы будут вызывать аналогичную активность в биологическом анализе [42, 43].Морфологическое сходство - это метод подобия, зависящий только от формы поверхности и зарядовых характеристик лигандов [44]. Морфологическое сходство определяется как функция Гаусса от различий в расстояниях молекулярных поверхностей 2 молекул в взвешенных точках наблюдения на однородной сетке. Вычисленные поверхностные расстояния включают как расстояния до ближайшей атомной поверхности, так и расстояния до донорных и акцепторных поверхностей. Эта функция зависит от относительного выравнивания молекул, и, следовательно, их выравнивание и конформация должны быть оптимизированы.Проблема конформационной оптимизации решается фрагментацией, конформационным поиском, выравниванием и оценкой, за которыми следует инкрементная реконструкция из выровненных фрагментов с высокими показателями. Проблема выравнивания решается за счет использования того факта, что две невыровненные молекулы или молекулярные фрагменты, которые имеют некоторую степень сходства, будут иметь некоторый соответствующий набор наблюдателей, которые видят одни и те же вещи. Оптимизация подобия 2 невыровненных молекул или молекулярных фрагментов выполняется путем нахождения похожих наборов наблюдателей для каждой молекулы, которые образуют треугольники одинакового размера [41, 44].

Скрининг In silico ADME / Tox

Инструменты компьютерного моделирования использовались для оценки биодоступности, растворимости в воде, потенциала гематоэнцефалического барьера, абсорбции в кишечнике человека, потенциала ингибирования фермента цитохрома P450 (т.е. CYP2D6), мутагенности и ингибирования hERG совпадений, полученных в результате скрининга базы данных. Биодоступность, растворимость в воде и всасывание в кишечнике человека оценивали с помощью программного обеспечения ACD / ADME Boxes (ACD Labs, Торонто, Канада; http: // www.acdlabs.com), а мутагенность, ингибирование hERG и CYP2D6 оценивали с помощью скрининга ACD / Tox (ACD Labs, Торонто, Канада; http://www.acdlabs.com).

Статистический анализ

Все значения были представлены как среднее +/- SEM или среднее +/- SD. Для статистического анализа использовались Microsoft Excel и Graphpad Prism 6. Двусторонний тест Стьюдента t был проведен для определения различий между двумя группами. При сравнении различий в более чем 2 группах был проведен однофакторный дисперсионный анализ ANOVA (тест Даннета).Статистически значимым считалось значение P <0,05, показанное как «*» для P <0,05, «**» для P <0,01 и «***» для P <0,001.

Дополнительная информация

S1 Рис. IC

50 и полные фармакокинетические профили миметиков NBD.

(A) Дозозависимая кривая миметиков NBD в диапазоне от 0 до 150 мкМ была определена с помощью анализов люциферазы NF-κB в клетках HEK293. (B) Полные фармакокинетические профили вводимых SR12460 и SR12343 i.v. или через желудочный зонд у мышей. Базовые данные можно найти в S1 Data. AUC% Extrap, процент площади под кривой, экстраполированной на бесконечность от T за последние до бесконечности; AUC INF_obs , площадь под кривой от 0 до бесконечности; AUC last , площадь под кривой от времени дозирования до последней измеряемой концентрации; C max , максимальная наблюдаемая концентрация; Cl obs , общий клиренс сыворотки; НЕК, клетки 293 почки эмбриона человека; IC 50 , половина максимальной ингибирующей концентрации; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; NF-κB, ядерный фактор κB; T 1/2 , период полураспада; T max , время максимальной концентрации.

https://doi.org/10.1371/journal.pbio.2004663.s002

(TIF)

S2 Рис. SR12343 снижает активацию NF-κB за счет нарушения фосфорилирования IKKα / β без воздействия на фосфорилирование TAK1.

(A) SR12343 в указанных концентрациях (0, 25, 50, 100 и 150 мкМ) ингибировал фосфорилирование IKKα / β и p65 и предотвращал деградацию IκBα. (B) SR12343 снижал индуцированное IL-1α фосфорилирование TAK1 и IKKβ в IKKα - / - MEF. IKK, IκB киназа; ИЛ-1, интерлейкин 1; MEF, эмбриональный фибробласт мыши; NF-κB, ядерный фактор κB.

https://doi.org/10.1371/journal.pbio.2004663.s003

(TIF)

S3 Фиг. Миметики NBD не проявляют влияния на массу тела у обработанных мышей

mdx .

(A) Масса тела отслеживалась у мышей mdx , подвергавшихся хроническому лечению, и не было обнаружено значительных различий. (B) Образцы сыворотки от мышей mdx, подвергавшихся хроническому лечению, анализировали на уровни AST, ALT и ALP, индикаторы повреждения печени, с использованием анализатора клинической химии Cobas c311. Базовые данные можно найти в S1 Data.ALP, щелочная фосфатаза; АЛТ, аланинаминотрансфераза; AST, аспартатаминотрансфераза; NBD, NEMO-связывающий домен; NEMO, основной модулятор NF-κB.

https://doi.org/10.1371/journal.pbio.2004663.s004

(TIF)

S4 Рис. Хроническое лечение миметиками NBD улучшает мышечную патологию путем ингибирования активности связывания ДНК NF-κB у мышей

mdx .

(A) Количественная оценка процента централизованных миоядер. (B) Большая область окрашивания гематоксилином-эозином ТА-мышц из разных групп лечения.(C) EMSA-анализ ДНК-связывающей активности NF-κB in vivo проводили с использованием экстрактов из тканей ТА от mdx мышей. Разовая доза SR12343 в дозе 30 мг / кг вводилась внутрибрюшинно. ТА-мышцы собирали через 2 часа после инъекции для анализа EMSA. Базовые данные можно найти в S1 Data. EMSA, анализ сдвига электрофоретической подвижности; внутрибрюшинно, внутрибрюшинно; NBD, NEMO-связывающий домен; NEMO, существенный модулятор NF-κB; NF-κB, ядерный фактор κB; TA, tibialis anterior.

https://doi.org/10.1371/journal.pbio.2004663.s005

(TIF)

Список литературы

  1. 1. Перкинс Н.Д. Интеграция клеточных сигнальных путей с функцией NF-kappaB и IKK. Обзор природы Молекулярная клеточная биология. 2007. 8 (1): 49–62. Epub 2006/12/22. pmid: 17183360.
  2. 2. Занди Э., Ротварф Д.М., Делхас М., Хаякава М., Карин М. Киназный комплекс IκB (IKK) содержит две субъединицы киназы, IKKα и IKKβ, необходимые для фосфорилирования IκB и активации NF-κB. Клетка. 1997. 91 (2): 243–52.http://dx.doi.org/10.1016/S0092-8674(00)80406-7. pmid: 41
  3. 3. Ямаока С., Куртуа Дж., Бессия С., Уайтсайд С.Т., Вейл Р., Агу Ф. и др. Комплементационное клонирование NEMO, компонента киназного комплекса IκB, необходимого для активации NF-κB. Клетка. 1998. 93 (7): 1231–40. pmid: 9657155
  4. 4. Рудольф Д., Йе В.К., Уэйкхэм А., Рудольф Б., Наллайнатан Д., Поттер Дж. И др. Тяжелая дегенерация печени и отсутствие активации NF-κB у мышей с дефицитом NEMO / IKKγ. Гены и развитие.2000. 14 (7): 854–62.
  5. 5. Мэй М.Дж., Д’Аквисто Ф., Мэдж Л.А., Глокнер Дж., Побер Дж. С., Гош С. Селективное ингибирование активации NF-kappaB пептидом, который блокирует взаимодействие NEMO с киназным комплексом IkappaB. Наука. 2000. 289 (5484): 1550–4. Epub 2000/09/01. pmid: 10968790.
  6. 6. Корнегай Дж., Петерсон Дж. М., Боган Д. Д., Клайн В., Боган Дж. Р., Доу Дж. Л. и др. Доставка NBD улучшает фенотип болезни золотистого ретривера, модель мышечной дистрофии Дюшенна.Скелетные мышцы. 2014; 4:18. Epub 2014/01/01. pmid: 25789154.
  7. 7. Ачарья С., Вильялта С.А., Баккар Н., Буфа-Интр Т., Янссен П.М., Каратерс М. и др. Взаимодействие передачи сигналов IKK / NF-kappaB в макрофагах и миофибриллах способствует мышечной дегенерации при мышечной дистрофии Дюшенна. Журнал клинических исследований. 2007. 117 (4): 889–901. Epub 2007/03/24. pmid: 17380205.
  8. 8. Рей Д.П., Ян М., Вачко Дж. Ф., Дауд М., О'Дей Т.Л., Рехман К.К. и др. Системная доставка связывающего домена NEMO / ингибирующего пептида IKKgamma молодым мышам mdx улучшает гистопатологию дистрофических скелетных мышц.Нейробиология болезни. 2011. 43 (3): 598–608. Epub 2011/06/01. pmid: 21624467.
  9. 9. Davé SH, Tilstra JS, Matsuoka K, Li F, Karrasch T., Uno JK, et al. Улучшение хронического колита у мышей с помощью пептид-опосредованной трансдукции ингибитора киназы IκB пептидом связывающего домена NEMO. Журнал иммунологии. 2007. 179 (11): 7852–9. pmid: 18025231
  10. 10. Tas S, Vervoordeldonk M, Hajji N, May M, Ghosh S, Tak P. Местное лечение селективным пептидом NEMO-связывающего домена, ингибитором киназы IkappaB, облегчает синовиальное воспаление.Исследования и терапия артрита. 2006; 8 (4): R86.
  11. 11. Джими Э., Аоки К., Сайто Х., Д’Акусто Ф., Мэй М.Дж., Накамура И. и др. Селективное ингибирование NF-каппа B блокирует остеокластогенез и предотвращает воспалительную деструкцию кости in vivo. Природная медицина. 2004. 10 (6): 617–24. Epub 2004/05/25. pmid: 15156202.
  12. 12. Гош А., Рой А., Лю Х, Кордовер Дж. Х., Муфсон Э. Дж., Хартли Д. М. и др. Селективное ингибирование активации NF-κB предотвращает потерю дофаминергических нейронов на мышиной модели болезни Паркинсона.Труды Национальной академии наук. 2007. 104 (47): 18754–9.
  13. 13. Огуиса А., Ресио С., Лазаро И., Маллавиа Б., Бланко Дж., Эджидо Дж. И др. Пептидное ингибирование пути киназы IκB / ядерного фактора-κB защищает от нефропатии и атеросклероза, связанных с диабетом, на мышиной модели диабета 1 типа. Диабетология. 2015. 58 (7): 1656–67. pmid: 25982245
  14. 14. Джими Э., Аоки К., Сайто Х., Д’Акусто Ф., Мэй М.Дж., Накамура И. и др. Селективное ингибирование NF-каппа B блокирует остеокластогенез и предотвращает воспалительное разрушение кости in vivo.Природная медицина. 2004. 10 (6): 617–24. http://www.nature.com/nm/journal/v10/n6/suppinfo/nm1054_S1.html. pmid: 15156202
  15. 15. Анкерманн Т., Райснер А., Виманн Т., Крамс М., Кёлер Х., Краузе М.Ф. Местное ингибирование ядерного фактора-κB усиливает уменьшение отека легких сурфактантом в модели лаважа дыхательных путей у поросят. Реанимационная медицина. 2005; 33 (6).
  16. 16. Мора А.Л., ЛаВой Дж., Маккин М., Стеценко А., Бригам К.Л., Паркер Р. и др. Предотвращение активации NF-κB in vivo с помощью проницаемого для клеток пептида-ингибитора NF-κB.Американский журнал физиологии - клеточная и молекулярная физиология легких. 2005; 289 (4): L536 – L44. pmid: 15951331
  17. 17. Habineza Ndikuyeze G, Gaurnier-Hausser A, Patel R, Baldwin AS, May MJ, Flood P, et al. Фаза I клинических испытаний системно доставляемого пептида связывающего домена NEMO у собак со спонтанной активированной B-клеточной подобной диффузной большой B-клеточной лимфомой. PLOS ONE. 2014; 9 (5): e95404. Epub 2014/05/07. pmid: 24798348.
  18. 18. Тилстра Дж.С., Робинсон А.Р., Ван Дж., Грегг С.К., Клаусон С.Л., Рей Д.П. и др.Ингибирование NF-kappaB задерживает вызванное повреждением ДНК старение и старение у мышей. Журнал клинических исследований. 2012. 122 (7): 2601–12. Epub 2012/06/19. pmid: 22706308.
  19. 19. Валлквист А., Хуанг Р., Танки Н., Ковелл Д. Оценка сходства химической структуры как индикатора торможения клеточного роста. Журнал химической информации и моделирования. 2006. 46 (1): 430–7. Epub 2006/01/24. pmid: 16426077.
  20. 20. Мартин Ю.К., Кофрон Ю.Л., Трафаген Л.М. Обладают ли структурно похожие молекулы аналогичной биологической активностью? Журнал медицинской химии.2002. 45 (19): 4350–8. Epub 2002/09/06. pmid: 12213076.
  21. 21. Руш М., Сильвиан Л., Бикслер С., Чен Л.Л., Чунг А., Боуз С. и др. Структура домена, связанного с NEMO / IKK, раскрывает архитектуру сайта взаимодействия. Состав. 2008. 16 (5): 798–808. http://dx.doi.org/10.1016/j.str.2008.02.012. pmid: 18462684
  22. 22. Вольбер Г., Дорнхофер А., Лангер Т. Эффективное наложение малых органических молекул с использованием трехмерных фармакофоров. J. Comput Aided Mol Des. 2006. 20 (12): 773–88.pmid: 17051340
  23. 23. Wolber G, Langer T. LigandScout: 3-D фармакофоры, полученные из лигандов, связанных с белками, и их использование в качестве виртуальных фильтров для скрининга. Журнал химической информации и моделирования. 2005. 45 (1): 160–9. Epub 2005/01/26. pmid: 15667141.
  24. 24. Джейн А. Морфологическое сходство: метод трехмерного молекулярного сходства коррелирует с распознаванием белок-лиганд. J. Comput Aided Mol Des. 2000. 14 (2): 199–213. pmid: 10721506
  25. 25. Tilstra JS, Gaddy DF, Zhao J, Davé SH, Niedernhofer LJ, Plevy SE и др.Фармакологическое ингибирование IKK / NF- [kgr] B заставляет антигенпрезентирующие клетки претерпевать TNF [agr] -зависимую запрограммированную гибель клеток, опосредованную ROS. Научные отчеты. 2014; 4.
  26. 26. Ирвин Дж. Дж., Шойчет Б. К.. ZINC - бесплатная база данных коммерчески доступных соединений для виртуального скрининга. Журнал химической информации и моделирования. 2005. 45 (1): 177–82.
  27. 27. May MJ, Marienfeld RB, Ghosh S. Характеристика связывающего домена IκB-киназы NEMO. Журнал биологической химии.2002. 277 (48): 45992–6000. pmid: 12244103
  28. 28. Булфилд G, Силлер WG, Уайт PA, Мур KJ. Х-хромосомно-связанная мышечная дистрофия (MDX) у мышей. Труды Национальной академии наук Соединенных Штатов Америки. 1984. 81 (4): 1189–92. pmid: 6583703
  29. 29. Рей Д.П., Ян М., Вачко Дж. Ф., Дауд М., О'Дей Т.Л., Рехман К.К. и др. Системная доставка связывающего домена NEMO / ингибирующего пептида IKKγ молодым мышам mdx улучшает гистопатологию дистрофических скелетных мышц.Нейробиология болезней. 2011. 43 (3): 598–608. http://dx.doi.org/10.1016/j.nbd.2011.05.008. pmid: 21624467
  30. 30. Acharyya S, Villalta SA, Bakkar N, Bupha-Intr T, Janssen PML, Carathers M и др. Взаимодействие передачи сигналов IKK / NF-κB в макрофагах и миофибриллах способствует мышечной дегенерации при мышечной дистрофии Дюшенна. Журнал клинических исследований. 2007. 117 (4): 889–901. pmid: 17380205
  31. 31. Мустата Г., Ли М., Зевола Н., Бакан А., Чжан Л., Эпперли М. и др.Разработка низкомолекулярных ингибиторов PUMA для смягчения гибели клеток, вызванной излучением. Актуальные темы медицинской химии. 2011; 11 (3): 281–90. pmid: 21320058
  32. 32. Golden MS, Cote SM, Sayeg M, Zerbe BS, Villar EA, Beglov D, et al. Комплексный экспериментальный и вычислительный анализ горячих точек энергии связывания на интерфейсе NF-κB Essential Modulator (NEMO) / IKKβ белок-белок. Журнал Американского химического общества. 2013. 135 (16): 6242–56. pmid: 23506214
  33. 33.Байма Е.Т., Гузова Дж. А., Матиалаган С., Нагец Е. Е., Харди М. М., Сонг Л. Р. и др. Новые сведения о клеточных механизмах противовоспалительного действия пептидов домена связывания основного модулятора NF-κB. Журнал биологической химии. 2010. 285 (18): 13498–506. pmid: 20167598
  34. 34. Кот С.М., Гилмор Т.Д., Шаффер Р., Вебер Ю., Боллам Р., Голден М.С. и др. Мутация несущественных цистеинов показывает, что основной модулятор NF-κB образует конститутивный нековалентный димер, который связывает IκB-киназу-β с высоким сродством.Биохимия. 2013. 52 (51): 9141–54.
  35. 35. Golden MS, Cote SM, Sayeg M, Zerbe BS, Villar EA, Beglov D, et al. Комплексный экспериментальный и вычислительный анализ горячих точек энергии связывания на интерфейсе NF-κB Essential Modulator / IKKβ белок-белок. Журнал Американского химического общества. 2013. 135 (16): 6242–56.
  36. 36. Солт Л.А., Мэдж Л.А., Orange JS, Май MJ. Индуцированная интерлейкином-1 активация NF-κB является NEMO-зависимой, но не требует IKKβ. Журнал биологической химии.2007. 282 (12): 8724–33. pmid: 17244613
  37. 37. Macian F, Lopez-Rodriguez C, Rao A. Партнеры в транскрипции: NFAT и AP-1. Онкоген. 2001. 20 (19): 2476–89. pmid: 11402342.
  38. 38. Вильялта С.А., Нгуен Х.Х., Дэн Б., Гото Т, Тидболл Дж. Изменения фенотипов макрофагов и конкуренция макрофагов за метаболизм аргинина влияют на тяжесть мышечной патологии при мышечной дистрофии. Молекулярная генетика человека. 2009. 18 (3): 482–96. pmid: 18996917
  39. 39. Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS.NF-κB контролирует рост и дифференцировку клеток посредством регуляции транскрипции циклина D1. Молекулярная и клеточная биология. 1999. 19 (8): 5785–99. pmid: 10409765
  40. 40. Chang MR, He Y, Khan TM, Kuruvilla DS, Garcia-Ordonez R, Corzo CA и др. Эффект против ожирения репрессора малых молекул RORγ. Молекулярная фармакология. 2015; 88 (1): 48–56. pmid: 254
  41. 41. Delgado ER, Yang J, So J, Leimgruber S, Kahn M, Ishitani T. и др. Идентификация и характеристика нового низкомолекулярного ингибитора передачи сигналов β-катенина.Американский журнал патологии. 2014. 184 (7): 2111–22. pmid: 24819961
  42. 42. Валлквист А., Хуанг Р., Танки Н., Ковелл Д. Оценка сходства химической структуры как индикатора ингибирования роста клеток. Журнал химической информации и моделирования. 2006. 46 (1): 430–7. pmid: 16426077
  43. 43. Мартин Ю.К., Кофрон Ю.Л., Трафаген Л.М. Обладают ли структурно похожие молекулы схожей биологической активностью? Журнал медицинской химии. 2002. 45 (19): 4350–8. pmid: 12213076
  44. 44.Джайн А.Н. Морфологическое сходство: метод трехмерного молекулярного сходства коррелирует с распознаванием белок-лиганд. J. Comput Aided Mol Des. 2000. 14 (2): 199–213. pmid: 10721506

Науки о здоровье

ЭМБАРГО: 3 вечера. (Восточный регион США) Чт, 8 апреля 1999 г.

Контактное лицо для СМИ: Нэнси Стрингер, (619) 543-6163, [email protected]

ИССЛЕДОВАНИЯ UCSD ОПИСЫВАЕТ ФУНКЦИЮ ФЕРМЕНТОВ, УЧАСТВУЮЩИХ В РАЗЛИЧНЫХ БИОЛОГИЧЕСКИХ ПРОЦЕССАХ
Работа представлена ​​на обложка Наука

исследователей в Медицинский факультет Калифорнийского университета в Сан-Диего (UCSD) обнаружил, что фермент, который ранее считался связанным только с воспалением, также является ключевым фактором образование кожи и запрограммированная гибель клеток.

Их выводы, доложенные в двух статьях и на обложке журнала Science от 9 апреля. последствия для фармацевтической промышленности и заложить основу для будущего развития лечение в трех очень разных областях - кожные заболевания, рак и воспалительные заболевания такие как астма, ревматоидный артрит и септический шок. В этом выпуске журнала Science два других документа и сопутствующая редакционная статья, посвященная дополнительному пониманию этого активность фермента.

"Эти документы обеспечить базовое понимание, необходимое для рационального развития очень специфические препараты ", - сказал Майкл Карин, доктор философии, профессор фармакологии и директор Программа биологии рака в Онкологическом центре UCSD, который руководил исследовательской группой UCSD. Карин также является профессором-исследователем Американского онкологического общества.

Фермент, белок киназный комплекс, называемый I-каппа-B киназой (или IKK), и его три субъединицы - альфа, бета и гамма - были впервые обнаружены в конце 1996 года в лаборатории Карин.(Белок киназы - это ферменты, которые регулируют функцию и метаболизм других белков путем добавления фосфатные группы к ним.) Благодаря этой знаменательной работе и работе, проделанной в других местах, он было показано, что IKK отвечает за контроль воспалительной реакции организма, которая это первая линия защиты от микробных инфекций. Потому что альфа и бета субъединицы IKK представляют собой протеинкиназы, сходные по своей химической структуре и обычно связаны вместе, исследователи полагали, что они выполняли одну и ту же функцию.

В этой новейшей работе Карин и его коллеги проверили эту теорию, разработав клеточные линии, в которых отсутствует активность либо альфа-, либо бета-субблоки. Они обнаружили, что подгруппа IKK-beta является необходим для активации всего комплекса IKK, отвечая на химические сигналы, которые вызвать воспалительную реакцию. Напротив, когда подразделение IKK-alpha было инактивированные, способность клеток реагировать на сигналы не изменялась.

Для дальнейшего тестирования в vitro, исследователи создали генно-инженерных мышей, лишенных гена, необходимого для производят ИКК-альфа. Они обнаружили, что у этих мышей развиваются нормальные воспалительные процессы. ответы, подтверждающие важность IKK-beta в этом процессе. (Группа Карин имеет также завершили работу с мышами без IKK-beta, но они еще не сообщили о своих результатов.)

Однако ИКК-альфа модель несовершенной мыши показала, к удивлению исследователей, что IKK-alpha служит совершенно невообразимая функция: она отвечает за ключевой этап в формировании верхний слой кожи, называемый эпидермисом.

В частности, ИКК-альфа контролирует пролиферацию и дифференцировку базальных клеток, лежащих в основе эпидермис. Обычно по мере созревания базальные клетки продвигаются вверх через эпидермиса и в конечном итоге образуют тонкий слой ороговевших клеток на поверхности кожи, которые служат барьером, предотвращающим потерю жидкости и легкое проникновение микроорганизмов. Отсутствие IKK-альфа приводит к неконтролируемому производству базальных клеток и полное отсутствие верхнего слоя ороговевших клеток кожи.

"Это открытие важно, потому что базальноклеточная карцинома - распространенная форма рака кожи - возникает из-за неконтролируемое разрастание базальных клеток, - сказала Карин. - Весьма вероятно, что некоторые вещи, которые идут не так, как надо при этом раке, напрямую связаны с новым путем мы определили ".

Параллельно работают, что могут иметь более широкие последствия, исследователи подтвердили, что IKK-beta является мастером контролирует воспалительные реакции, а также участвует в защите клеток от запрограммированная гибель клеток, процесс, известный как апоптоз.

Обычно воспалительная реакция - это защитная реакция организма от микробных захватчиков. В однако в некоторых случаях реакция может быть чрезмерно агрессивной и повреждать здоровые ткани; в экстремальные ситуации могут привести к смерти. Воспаление также может стать хроническим, что приведет к такие заболевания, как астма или артрит.

Исследователям известно что IKK и белок, называемый ядерным фактором-каппа-B (NF-kappa-B), являются центральными участниками в каскад событий, ведущих к воспалительной реакции.NF-kappa-B - мастер фактор транскрипции - белок, участвующий в регуляции генов. ИКК регулирует деятельность NF-каппа-B, но до сих пор не было известно, как именно это происходит.

В обеих клеточных культурах а у мышей с дефицитом IKK-альфа команда UCSD показала, что пока IKK-бета остается активный, воспалительная реакция в норме. С другой стороны, инактивация IKK-бета препятствует воспалительной реакции.

«До этой работы считалось, что вам придется подавить обе подъединицы IKK, альфа и бета, чтобы заблокировать активация NF-каппа-B и воспалительный ответ. Теперь ясно, что фармацевтическая промышленность должна сосредоточить свои усилия на разработке ингибиторов только для - IKK-beta, - сказала Карин.

Предыдущая работа также показали, что некоторые опухоли, которые плохо реагируют на лучевую или химиотерапию содержит высокий уровень NF-каппа-B.Последующие работы подтвердили, что NF-kappa-B активно защищает клетки от гибели клеток.

"Потому что мы сейчас знайте, что субъединица IKK-beta отвечает за активацию NF-kappa-B, которая защищает клетки от этого убивающего эффекта, само собой разумеется, что ингибиторы IKK-бета должен повышать чувствительность опухолей к обычной химиотерапии или облучению », - сказала Карин. "Но мы должны научиться избирательно подавлять бета-фермент в опухоли и не в других типах клеток.Это будет проблемой, но я считаю, что лекарство с будут найдены подходящие свойства ".

Молекулярный биолог, Карин занимает 12-е место в списке «самых горячих биомедицинских исследователей 1990-х годов» по ​​версии Science Watch, издание, отслеживающее тенденции и результаты фундаментальных исследований. С 1981 года более 70 его работ были процитированы более 100 раз каждая, и пять статей были процитированы более 1000 раз каждая.

Соавторы по статье под названием «Аномальный морфогенез, но интактная активация IKK у мышей, лишенных IKK-альфа-субъединица I-каппа-B-киназы - это Иньлин Ху, Вероник Бод и Мирей. Делхас, Отдел Фармакологии; Пэйлинь Чжан, отделение патологии; Томас Деринк и Марк Эллисман, отдел неврологии; Рэндалл Джонсон, Департамент Биология. Соавторы статьи «Положительное и отрицательное регулирование Активность киназы I-каппа-B посредством фосфорилирования субъединицы IKK-бета "Delhase, Макио Хаякава и Йи Чен, отдел фармакологии.Другие сотрудники, участвующие в Созданием и анализом мышей с дефицитом IKK-бета являются Zhi-Wei Li, Wenming Chu и Дэвид Ротварф. Исследование было поддержано Национальными институтами здравоохранения (Национальные институты здравоохранения). Институт наук о здоровье окружающей среды, Национальный институт аллергии и инфекций Болезней), Американского онкологического общества и Министерства энергетики США.

Примечание: Копии документы можно получить у Габриэля Паала в Информационном бюро AAAS, 202 / 326-6421 или напишите по электронной почте gpaal @ aaas.орг.

81095_16xpu.pdf

% PDF-1.4 % 73 0 объект > эндобдж 71 0 объект > поток Acrobat Distiller 5.0.5 (Windows) 2004-06-08T13: 51: 14Z2021-04-02T09: 12: 57-07: 002021-04-02T09: 12: 57-07: 00application / pdf

  • 81095_16xpu.pdf
  • uuid: a368a1eb-1dd1-11b2-0a00-7e0827fd5800uuid: a368a1ee-1dd1-11b2-0a00-6a0000000000 конечный поток эндобдж 68 0 объект > эндобдж 67 0 объект > эндобдж 69 0 объект > эндобдж 39 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 42 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 45 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 48 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 51 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 54 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [9 9 621 801] / Type / Page >> эндобдж 123 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 143 0 объект [150 0 R 151 0 R 152 0 R 153 0 R 154 0 R 155 0 R] эндобдж 144 0 объект > поток q 287.5 0 0 75 168,75 690 см / Im0 Do Q BT / T1_0 1 Тс 10 0 0 10 326.25977 591.99982 тм () Tj 0 0 1 рг -9.73 0 Тд (10.1101 / gad.1188204) Tj 0 г -16.89598 0 Тд (Доступ к самой последней версии на сайте doi 🙂 Tj 9,78299 1 тд () Tj / T1_1 1 Тс -1,44499 0 тд (18:) Tj / T1_0 1 Тс -2,78 0 тд (2004,) Tj / T1_2 1 Тс -5.558 0 Тд (Genes Dev. \ 240) Tj / T1_0 1 Тс 0 1.00001 TD (\ 240) Tj 0 1 ТД (Ruiqiong Ran, Aigang Lu, Lu Zhang и др.) Tj Т * (\ 240) Tj / T1_1 1 Тс 15 0 0 15 169.07951 641.99997 тм (Сигнал выживания B) Tj / T1_3 1 Тс -0.549 0 Тд (k) Tj / T1_1 1 Тс -6.72297 0 Тд (ухудшая NF-) Tj 27,52585 1 тд (и) Tj / T1_3 1 Тс -0,411 0 Тд (g) Tj / T1_1 1 Тс -27.11485 0 Тд (Hsp70 способствует TNF-опосредованному апоптозу путем связывания IKK) Tj ET 60 580 м 565 580 л 0 0 мес. S BT ET BT / T1_0 1 Тс 11 0 0 11 144,942 548,99997 тм (\ 240) Tj / T1_1 1 Тс -5.11299 1 Td (Ссылки) Tj ET BT / T1_0 1 Тс 10 0 0 10 165 540,99994 тм (\ 240) Tj 30.00783 1 тд () Tj 0 0 1 рг / T1_1 1 Тс -30.00783 0 Тд (http://genesdev.cshlp.org/content/18/12/1466.full.html#ref-list-1)Tj 0 г / T1_0 1 Тс 0 1.00001 TD (Эта статья цитирует 61 статью, 31 из которых можно получить бесплатно по адресу:) Tj ET BT / T1_0 1 Тс 11 0 0 11 144,942 518,99997 тм (\ 240) Tj / T1_1 1 Тс -3,44598 1 тд (Лицензия) Tj ET BT / T1_1 1 Тс 11 0 0 11 108,86 185 492,99997 тм (Сервис) Tj -3,16599 1 тд (Оповещение по электронной почте) Tj ET BT / T1_0 1 Тс 10 0 0 10 165 484,99994 тм (\ 240) Tj 17.39696 1 Td () Tj 0 0 1 рг / T1_1 1 Тс -4,892 0 Тд (нажмите здесь.) Tj 0 г / T1_0 1 Тс -12.50496 0 Тд (правый угол статьи или) Tj Т * (Получайте бесплатные уведомления по электронной почте, когда новые статьи цитируют эту статью - зарегистрируйтесь \ в рамке вверху) Tj ET 60 472 кв.м. 565 472 л 0 0 мес. S BT ET q 468 0 0 60 78.5117 см -1.00001 TL / Im1 Do Q 60 77 кв.м. 565 77 л 0 0 мес. S BT ET BT / T1_0 1 Тс 10 0 0 10 62 51 тм (Пресса лаборатории Колд-Спринг-Харбор) Tj ET BT / T1_0 1 Тс 8 0 0 8 503,63574 788 тм () Tj 0 0 1 рг -16.44997 0 Тд (Пресса лаборатории Колд-Спринг-Харбор) Tj 0 г -14.17399 0 Тд (2 апреля 2021 г. - опубликовано) Tj 0 0 1 рг -8.67099 0 Тд (genesdev.cshlp.org) Tj 0 г -8.11399 0 Тд (Скачано с) Tj ET конечный поток эндобдж 148 0 объект > / Filter / FlateDecode / Height 300 / Length 73148 / Name / X / Subtype / Image / Type / XObject / Width 1150 >> stream Hypq ޽ lJjBa 80 @ bA "pRHB) CSJP (M` * jQC`Ӻ \ =} Oaq 'ٍ3 ~ ?ly |` #

    Вещества Marasmius oreades блокируют активность NF-κB посредством вмешательства в путь активации IKK

  • 1.

    Аггарвал BB (2004) Ядерный фактор-κB: враг внутри. Cancer Cell 6: 203–208

    PubMed Статья CAS Google Scholar

  • 2.

    Занди Э., Карин М. (1999) Преодоление разрыва: состав, регуляция и физиологическая функция киназного комплекса IκB. Mol Cell Biol 19: 4547–4551

    PubMed CAS Google Scholar

  • 3.

    Pahl H (1999) Активаторы и гены-мишени факторов транскрипции Rel / NF-κB.Онкоген 18: 6853–6866

    PubMed Статья CAS Google Scholar

  • 4.

    Manson MM, Holloway KA, Howells LM, Hudson EA, Plummer SM, Squires MS, Prigent SA (2000) Модуляция путей передачи сигнала химиопрофилактическими агентами. Химиопротекция 28 (2): 7–12

    CAS Google Scholar

  • 5.

    Карин М., Цао И, Гретен FR, Ли З.В. (2002) NF-κB при раке: от невинного свидетеля до главного виновника.Nat Rev Cancer 2: 301–310

    PubMed Статья CAS Google Scholar

  • 6.

    Вассер С.П., Вейс А.Л. (1999a) Лечебные свойства веществ, встречающихся в грибах высших базидиомицетов: современные перспективы (Обзор). Int J Med Mushr 1: 31–62

    CAS Google Scholar

  • 7.

    Вассер С.П., Вейс А.Л. (1999b) Терапевтические эффекты веществ, встречающихся в грибах высших базидиомицетов: современная перспектива.Crit Rev Immunol 19: 65–96

    PubMed CAS Google Scholar

  • 8.

    Халперн Г.М., Миллер А.Х. (2002) Лекарственные грибы. Древние средства от современных недугов . M. Evans and Company Inc., Нью-Йорк

    Google Scholar

  • 9.

    Петрова Р.Д., Вассер С.П., Махайна Дж.А., Денчев С.М., Нево Э. (2005) Потенциальная роль лекарственных грибов в лечении рака груди: современные знания и перспективы на будущее.Int J Med Mushr 7 (1): 141–156

    Статья CAS Google Scholar

  • 10.

    Erkel G, Anke T, Sterner O (1996) Ингибирование активации NF-κB панепоксидоном. Biochem Biophys Res Commun 226: 214–221

    PubMed Статья CAS Google Scholar

  • 11.

    Mattila P, Könkö K, Eurola M, Pihlava JM, Astola J, Vahteristo L, Hietaniemi V, Kumpulainen J, Valtonen M, Piironen V (2001) Содержание витаминов, минеральных элементов и некоторых фенольных соединений в культивируемые грибы.J Agric Food Chem 49: 2343–2348

    PubMed Статья CAS Google Scholar

  • 12.

    Nakamura T, Akiyama Y, Matsugo S, Uzuka Y, Shibata K, Kawagishi H (2003) Очистка кофейной кислоты в качестве антиоксиданта из мицелия погруженной культуры Phellinus linteus (Berk. Et Curt.) Teng. (Aphyllophoromycetidae). Int J Med Mushr 5: 163–167

    Статья CAS Google Scholar

  • 13.

    Park YM, Kim IT, Park HJ, Choi JW, Park KY, Lee JD, Nam BH, Kim DG, Lee JY, Lee KT (2004) Противовоспалительные и антиноцицептивные эффекты метанольного экстракта Fomes fomentarius . Biol Pharm Bull 27 (10): 1588–1593

    PubMed Статья CAS Google Scholar

  • 14.

    Lorenzen K, Anke T (1998) Базидиомицеты как источник новых биоактивных природных продуктов. Curr Organic Chem 2: 329–364

    CAS Google Scholar

  • 15.

    Anke T, Kupka J, Schramm G, Steglich W (1980) Антибиотики из базидиомицетов. X. Скородонин, новый антибактериальный и противогрибковый метаболит из Marasmius scorodonius (Fr.) Fr. J Antibiot (Токио) 33 (5): 463–467

    CAS Google Scholar

  • 16.

    Tobe Y, Yamashita D, Takahashi T, Inata M, Sato J, Kakiuchi K, Kobiro K, Odaira Y (1990) Синтез (±) -маразминовой кислоты посредством перегруппировки 1-оксаспирогексана. J Am Chem Soc 112: 775–779

    Статья CAS Google Scholar

  • 17.

    Дэвис Д.Г., Ходж П. (2005) Биосинтез аллен (-) - маразина у Marasmius ramealis . Org Biomol Chem 3 (9): 1690–1693

    PubMed Статья CAS Google Scholar

  • 18.

    Петрова Р.Д., Махаджна Дж., Резник А.З., Вассер С.П., Денчев С.М., Нево Э. (2007) Грибковые вещества как модуляторы пути активации NF-κB. Mol Biol Rep 34 (3): 145–154

    PubMed Статья CAS Google Scholar

  • 19.

    Talwar GP (1974) Справочник по практической иммунологии . Национальный книжный фонд, Нью-Дели

    Google Scholar

  • 20.

    Бар-Шай М., Резник А.З. (2006) Пероксинитрит индуцирует альтернативный путь активации NF-κB в миобластах крыс L8. Антиоксидный окислительно-восстановительный сигнал 8 (3–4): 639–652

    PubMed Статья CAS Google Scholar

  • 21.

    Зайдман Б.З., Вассер С.П., Нево Е., Вассер Дж. (2007a) Андрогенные рецепторы-зависимые и независимые механизмы опосредуют активность Ganoderma lucidum в клетках рака простаты LNCaP.Int J Oncol 31 (4): 959–967

    PubMed CAS Google Scholar

  • 22.

    Зайдман Б.З., Вассер С.П., Нево Э., Махаджна Дж. (2007b) Coprinus comatus и Ganoderma lucidum влияют на функцию рецепторов андрогенов в клетках рака простаты LNCaP. Mol Biol Rep (в печати)

  • 23.

    Garg A, Aggarwal BB (2002) Фактор ядерной транскрипции-κB как мишень для разработки лекарств от рака. Лейкемия 16: 1053–1068

    PubMed Статья CAS Google Scholar

  • 24.

    Дебатин К.М. (2004) Пути апоптоза при раке и терапии рака. Cancer Immunol Immunother 53: 153–159

    PubMed Статья Google Scholar

  • 25.

    Park YM, Won JH, Kim YH, Choi JW, Park HJ, Lee KT (2005) Противовоспалительные и антиноцицептивные эффекты метанольного экстракта Inonotus obliquus in vivo и in vitro. J Ethnopharmacol 101: 120–128

    PubMed Статья Google Scholar

  • 26.

    Hsieh T, Wu P, Park S, Wu JM (2006) Индукция изменений клеточного цикла и модуляция апоптогенного / антиапоптотического и внеклеточного сигнального регуляторного белка с помощью водных экстрактов I’m-Yunity (PSP). BMC Compl Alt Med 1–15

  • 27.

    Korsmeyer SJ (1999) Семейство генов BCL-2 и регуляция запрограммированной гибели клеток. Cancer Res 59: 1693–1700

    PubMed CAS Google Scholar

  • 28.

    Ramachandran C, You W (1999) Дифференциальная чувствительность эпителиальных линий молочной железы человека и клеточных линий карциномы молочной железы к куркумину. Лечение рака груди 54 (3): 269–278

    PubMed Статья CAS Google Scholar

  • Дефицит иммунного ответа 5 и Кенни

    Идентифицирован киназный комплекс IkappaB дрозофилы, содержащий DmIKKß (иммунный ответ с дефицитом 5) и DmIKKγ (Kenny), гомологи белков IKKß и IKKγ человека.Этот комплекс необходим для сигнально-зависимого расщепления Relish, члена группы Семейство белков-активаторов транскрипции Rel, а также для активация генов антибактериального иммунного ответа. Кроме того, активированный комплекс DmIKK, а также рекомбинантный DmIKKß, может фосфорилировать Relish in vitro. Таким образом, предлагается, чтобы Киназный комплекс IkappaB дрозофилы функционирует, по крайней мере частично, индуцируя протеолитическое расщепление Relish. N конечная точка Затем смак перемещается в ядро ​​и активирует транскрипцию. генов антибактериального иммунного ответа.Примечательно, что это Киназный комплекс Drosophila IkappaB не требуется для активация белков Rel Dif и Dorsal через Toll сигнальный путь, который важен для противогрибкового иммунитета и формирование дорсовентрального паттерна на раннем этапе развития. Таким образом, еще предстоит идентифицированный комплекс киназы IkappaB должен быть необходим для белка Rel активация через сигнальный путь Toll (Silverman, 2000).

    Для идентификации компонентов сигнализации, необходимых для Иммунный ответ дрозофилы - обратный генетический подход с использованием генома дрозофилы Проект был осуществлен.Последовательность кДНК с гомологией киназному домену гены IKK человека были идентифицированы в базе данных BDGP EST. Исследование аминокислотной последовательности кодируемого белка, которая была обозначенный DmIKKß ( Drosophila melanogaster IKKß), демонстрирует значительное сходство с N-концевой областью hIKKalpha и hIKKß, но больше похож на hIKKß. Аминокислотная последовательность C-конца DmIKKß лишь слабо связано с соответствующие области IKKalpha и IKKß.Предсказанная спиральная спираль может быть обнаружена в области, соответствующей прогнозируемой спиральной спирали лейциновой молнии hIKKalpha и hIKKß. Ген DmIKKß отображается на хромосомное местоположение 89B, как определено с помощью массива фильтров BDGP P1 (Silverman, 2000).

    Белки IKKalpha и IKKß млекопитающих представляют собой обнаружен в высокомолекулярном киназном комплексе IkappaB, который включает структурный компонент IKKγ или NEMO. Чтобы исследовать возможность того, что DmIKKß также является компонентом подобного киназного комплекса, дрожжевого двухгибридный скрининг проводили с использованием DmIKKß в качестве приманки.Дрозофила личиночная библиотека кДНК была проверена, и в общей сложности 85 независимых положительные клоны были проанализированы. Было обнаружено, что все эти клоны содержат перекрывающиеся вставки из кДНК, кодирующей Белок дрозофилы, гомологичный hIKKγ, прежде всего, в его Конечная точка C. Этот ген, далее обозначаемый как DmIKKγ , отображается в хромосомном положении 60E, как определено с помощью BDGP. Массив фильтров P1. Прогнозы вторичной структуры белка, кодируемого DmIKKγ , предполагает существование несколько областей спиральной катушки.Общая аминокислотная последовательность гомология между DmIKKγ и hIKKγ предполагает предполагаемое структурные и функциональные отношения между двумя белками, особенно в их С-концевых половинах. DmIKKß и DmIKKγ взаимодействуют с образованием комплекса как in vivo, так и in vitro (Silverman, 2000).

    Чтобы определить, участвуют ли DmIKKß и DmIKKγ в Для активации антибактериальных генов была сконструирована LPS-индуцируемая клеточная линия дрозофилы для экспрессии различных версий этих генов.Когда клетки S2 * обрабатывают ЛПС, экспрессия антибактериальных индуцируются пептидные гены, такие как диптерицин , цекропин и аттацин . Таким образом, клетки S2 * стабильно трансфицировали плазмидами, которые экспрессируют дикого типа или потенциально доминантно-отрицательные версии DmIKKß и DmIKKγ. под контролем промотора металлотионеина, индуцируемого медью. Были созданы четыре клеточные линии, которые экспрессируют один из следующих белков: DmIKKß дикого типа, DmIKKß K50A, DmIKKγ дикого типа, или DmIKKγ 201-387.DmIKKß K50A был выбран потому, что мутации в hIKKalpha или hIKKß, которые изменяют консервативный лизин в связывающий АТФ домен, создают доминантные отрицательные белки, тогда как DmIKKγ 201-387 был разработан, потому что подобным образом укороченный hIKKγ действует как доминантно-отрицательный мутант в клетках человека. Полноразмерный hIKKγ также может выступать в качестве доминирующего негатива, когда экспрессируется на высоких уровнях, предположительно путем титрования. ограничивающие компоненты, необходимые для сборки функционального комплекса. DmIKKß и DmIKKγ взаимодействуют с образованием комплекса как in vivo, так и in vitro (Silverman, 2000).

    После добавления меди белки DmIKK быстро продуцируются при высокие уровни, обнаруженные с помощью иммуноблоттинга. К определить, блокируют ли эти белки DmIKK индукцию LPS экспрессия антибактериального пептида в клетках S2 *, стабильных клеточных линиях были сначала обработаны медью, чтобы вызвать экспрессию DmIKKs и затем стимулировали LPS. DmIKKß K50A блокирует индукцию LPS из диптерицина, цекропина и аттацина гены.Точно так же либо в полный рост, либо в усеченном версии DmIKKγ являются мощными ингибиторами антибактериального пептида экспрессия гена. Эти данные ясно показывают, что DmIKKß K50A, DmIKKγ полноразмерные, или DmIKKγ 201-387 , сильно ингибируют диптерицин, цекропин и ген аттацина индукция. Напротив, экспрессия DmIKKß дикого типа незначительно снижает уровень экспрессии этих генов. Сделан вывод, что DmIKKß и DmIKKγ необходимы для активации экспрессия антибактериальных генов в ответ на ЛПС (Silverman, 2000).

    Генетические исследования показали, что Ген Drosophila Relish необходим для антибактериальной иммунная реакция. Бактериальная инфекция или ЛПС лечение активирует эндопротеолитическое расщепление Relish. Один раз после расщепления N-концевой RHD Relish перемещается в ядро, где он активирует транскрипцию антибактериальных генов. Учитывая, что сверхэкспрессия доминантно-негативных DmIKKß или DmIKKγ блокирует индукцию антибактериальные пептидные гены, вполне вероятно, что DmIKKß (и DmIKK complex) функционирует в сигнальном пути, ведущем к расщепление Смаком.Чтобы проверить эту возможность, DmIKK сверхэкспрессирующие клеточные линии были использованы, чтобы проследить судьбу Relish расщепление белков. Стабильные клеточные линии и родительские клетки были сначала обрабатывали медью, а затем индуцировали LPS в течение 15 мин. LPS обработка родительских клеток или любой из стабильных линий, которые были не обработанный медью, вызывает расщепление Relish. Смаковать во всю длину (~ 110 кДа) расщепляется с образованием фрагментов ~ 68 кДа и ~ 49 kD, соответствующие N- и C-концевым фрагментам соответственно.Экспрессия DmIKKß K50A, DmIKKγ или DmIKKγ 201-387 блокирует расщепление Relish. Сверхэкспрессия DmIKKß дикого типа вызывает небольшое скопление полнометражного Relish (Silverman, 2000).

    Для получения дополнительных доказательств того, что DmIKKß и DmIKKγ являются необходим для LPS-индуцированной экспрессии антибактериального гена, ингибирующий эффект двухцепочечной РНК (дцРНК), также называемый как RNAi. Наличие геноспецифичных молекул дцРНК в Drosophila или Caenorhabditis elegans Было обнаружено эмбриона. показано, что дестабилизирует родственные мРНК.дцРНК, соответствующая гена DmIKKγ или DmIKKß было синтезировано в vitro и трансфицировали в LPS-индуцибельную клеточную линию S2 *. Трансфекция ген-специфической дцРНК вызывает значительное снижение количество соответствующей мРНК. Например, DmIKKγ дцРНК снижает мРНК DmIKKγ до почти неопределяемых уровней, в то время как DmIKKγ или LacZ дцРНК не влияет на уровни мРНК DmIKKγ .Уровни белка DmIKKγ также значительно снижаются только в этих клетках. трансфицированные DmIKKγ дцРНК; однако важно отметить что, хотя белок DmIKKγ снижается примерно в 10 раз, он все еще обнаруживается после обработки РНКи. Важно отметить, что опосредованная дцРНК вмешательство либо DmIKKß , либо DmIKKγ значительно подавляет индуцированную ЛПС экспрессию антибактериальных генов, такие как Аттацин, Цекропин и Диптерицин .ЛПС-индуцированный расщепление Relish также ингибируется либо DmIKKß , либо DmIKKγ дцРНК. Полноразмерный белок Relish сохраняется после индукции LPS только в тех дорожках, которые были трансфицированы. с DmIKK дцРНК. Хотя подавление расщепления смакой наблюдаемая с DmIKK РНКи не так драматична, как наблюдаемая с доминирующие отрицательные DmIKKs, ясно, что полноразмерные Прикус не так эффективно расщепляется в тех клетках с пониженным уровнем из DmIKKß или DmIKKγ.Как в доминантно-негативном, так и в РНКи экспериментов всегда наблюдается более сильное торможение на уровень транскрипции по сравнению с уровнем белка. Это говорит о том, что небольшие возмущения количества ядерных перемещенный Relish может иметь драматические эффекты на уровне активация транскрипции. Небольшие различия в количестве Было показано, что факторы транскрипции проявляют действие "все или ничего" на промоторы, требующие совместной сборки транскрипции энхансерные комплексы.дцРНК-опосредованная интерференция не создает нулевой аллель. Таким образом, уменьшенное количество Relish расщепление и экспрессия антибактериальных генов все еще наблюдаются в Клетки, обработанные РНКи, скорее всего, связаны с оставшимися DmIKK, обнаруженными в эти клетки. Как доминантно-отрицательные эксперименты, так и эксперименты с РНКи показывают, что DmIKKß и DmIKKγ необходимы для LPS-индуцированного вкуса. эндопротеолитическое расщепление и активация транскрипции гены антибактериальных пептидов in vivo (Silverman, 2000).

    Путь передачи сигналов Toll, ведущий к кактусам необходима деградация и активация Dif и Dorsal. для противогрибкового иммунного ответа, а также для раннего эмбрионального выкройка. Комплекс DmIKKß / γ может участвовать в Toll сигнальный путь в дополнение к его роли в антибактериальном пути. Чтобы напрямую проверить эту возможность, была использована техника RNAi с Клеточная линия дрозофилы, специально разработанная для анализа Toll сигнальный путь.Клетки Schneider S2 * стабильно трансфицировали torso-pelle Ген слияния , контролируемый промотором металлотионеина, создает клеточную линию S2 * tpll. Предыдущие исследования продемонстрировали, что слияние трансмембранного домена torso с геном pelle создает конститутивно активную киназу pelle, которая может стимулировать путь передачи сигнала Toll в эмбрионах мух или в клетках культуры тканей. В клеточной линии S2 * tpll, добавление меди приводит к активации Платный противогрибковый путь. Дрозомицин транскрипция индуцируется, но транскрипция диптерицина не изменяется. Трансфекция дцРНК в клетки S2 * tpll приводит к специфической потере соответствующей мРНК и белка. DmIKKγ дцРНК вызывает существенное снижение уровня белка DmIKKγ. Однако ни DmIKKß и DmIKKγ дцРНК блокируют Торс-пелле-опосредованная активация транскрипции дрозомицина . Эти эксперименты убедительно доказывают, что DmIKKß и DmIKKγ не требуются для Toll-опосредованного противогрибковый путь, но необходимы для LPS-индуцированного антибактериального пути (Silverman, 2000).

    Обнаружение того, что доминантно-отрицательные DmIKKs или DmIKK RNAi могут блокировать Расщепление вкуса и зависимая от вкуса активация гена предполагают, что Прикосновение может быть настоящей целью комплекса DmIKK. Чтобы проверить это Возможно, были проведены эксперименты, чтобы определить, действительно ли DmIKKß или комплекс DmIKK может фосфорилировать белок Relish in vitro. Помеченный флагом Relish был иммунопреципитирован антителами Flag из Клеточная линия Шнайдера, которая экспрессирует очень высокие уровни меченный эпитопом белок.Иммунопреципитированный вкус был затем используется в качестве субстрата с рекомбинантным DmIKKß в киназном анализе с использованием [γ- 32 P] АТФ. Полоса размером с Relish была помечена рекомбинантной киназой как 32 P. В качестве контроля используются экстракты родительской линии клеток Шнайдера, которые не выражает вкус флага, также использовались в флаге иммунопреципитация. Когда эти иммунопреципитаты использовались в качестве субстратов для DmIKKß фосфорилирования Relish не наблюдалось.Чтобы дополнительно продемонстрировать, что фосфорилированная полоса Relish, аналогичный эксперимент был проведен с анти-Relish. антитела вместо антител Flag для осаждения Relish. Опять же полоса, соответствующая Relish, была фосфорилирована в DmIKKß-зависимый способ. Сделан вывод, что DmIKKß может непосредственно фосфорилировать Relish (Silverman, 2000).

    Чтобы определить, является ли это фосфорилирование DmIKKβ Relish специфичность, способность других родственных киназ фосфорилировать Relish был протестирован.Для этих экспериментов специфика DmIKKß сравнивали с рекомбинантным человеческим IKKß и ИККепсилон. В то время как DmIKKß легко фосфорилирует Relish, фосфорилирование не наблюдается ни с hIKKß, ни с hIKKepsilon. Когда эти же рекомбинантные IKK человека использовали в анализе киназы GST-IkappaBalpha, они оба были активными. Таким образом, способность фосфорилировать Relish не является общей для киназ Drosophila и IkappaB человека. Предварительные эксперименты показали, что DmIKKß может фосфорилируют линкерную область между RHD и анкириновым доменом.Удивительно, но DmIKKß может также фосфорилировать кактус и IkappaBalpha, и это фосфорилирование происходит внутри N-концевой регуляторный домен, необходимый для сигнально-зависимая деградация протеасомой. Таким образом, возможность конкретно фосфорилированные белки IkappaB являются общими для дрозофилы и киназы IkappaB человека, тогда как только киназа дрозофилы может фосфорилированный Смак. Киназный комплекс IkappaB млекопитающих имеет было показано, что он фосфорилирует p105; однако это фосфорилирование ведет скорее к его деградации, чем к его переработке (Silverman, 2000).

    Проверить возможность того, что активированный комплекс DmIKK может фосфорилат Relish, был проведен иммунокомплексный киназный анализ. Сначала комплекс DmIKK осаждали из LPS-индуцибельной линии клеток Шнайдера с использованием антитела против DmIKKγ. Это антитело распознает эндогенный DmIKKγ, который экспрессируется в этой клеточной линии. Хотя анти-DmIKKß антитела менее чувствительны (DmIKKß не обнаруживается в сырых экстрактах), Белок DmIKKß может быть обнаружен после иммунопреципитации антителами против DmIKKγ.Эксперименты по иммунопреципитации проводили с экстрактами, полученными из клеток, обработанных LPS или оставленных необработанными; никаких различий не было детектируется, с или без LPS, в уровнях экспрессии и преципитации DmIKKß или DmIKKγ. Однако LPS вызывает специфическое повышение уровня активности киназы Relish, которое было обнаружено в иммунопреципитированном комплексе DmIKK. Таким образом Комплекс DmIKK, который осаждается антителами против DmIKKγ содержит LPS-индуцибельную активность киназы Relish.Это наблюдение поддерживает точку зрения, что DmIKKß и DmIKKγ образуют (часть) LPS-индуцибельный киназный комплекс, который фосфорилирует Relish, активируя его расщепление в ответ на LPS (Silverman, 2000).

    Роль IKKgamma дрозофилы в Toll-независимом антибактериальном иммунном ответе

    Были созданы мутанты с потерей функции в гомологе дрозофилы компонента IKK γ комплекса I-каппа B-киназы (IKK) млекопитающих.Дрозофила IKK γ необходим для зависимой от вкуса иммунной индукции генов кодирования антибактериальных пептидов и устойчивости к инфекциям Escherichia coli . Однако это не требуется для Toll-DIF-зависимого противогрибкового хозяина. оборона. Результаты указывают на различные механизмы контроля Rel-like трансактиваторы DIF и Relish во врожденном иммунном ответе дрозофилы и показывают что Drosophila Toll не передает сигнал через IKK γ-зависимую передачу сигналов сложный.Таким образом, в отличие от воспалительного ответа позвоночных, IKK γ является необходим для активации только одного иммунного сигнального пути у Drosophila (Rutschmann, 2000).

    Антибактериальная часть врожденного иммунного ответа у дрозофилы требует киназы IkappaB

    Ген ird5 был идентифицирован в ходе генетического скрининга мутантов иммунного ответа дрозофилы. Мутации в ird5 предотвращают индукцию шести генов антибактериальных пептидов в ответ на инфекцию, но не влияют на индукцию гена противогрибкового пептида.В соответствии с этим обнаружено, что Escherichia coli выживают в 100 раз лучше у ird5 взрослых особей, чем у животных дикого типа. Ген ird5 кодирует Drosophila гомолог киназ IkappaB (IKKs) млекопитающих и является каталитической субъединицей комплекса IKK, который содержит IKKγ (Kenny) в качестве регуляторной субъединицы. Фенотип и последовательность ird5 предполагают, что этот ген специфически необходим для активации Relish, члена семейства Drosophila NF-kappaB (Lu, 2001).

    Мутации в ird5 предотвращают индукцию репортерный ген диптерицин-lacZ в ответ на инфекцию и также предотвращают индукцию транскрипции эндогенного ген диптерицина . E. coli -индуцированная экспрессия всех семи классов генов антимикробных пептидов у ird5 мутантных личинок были исследованы с помощью РНК-блот-гибридизации, включая гены, кодирующие антибактериальные (диптерицин, цекропин A, Дефенсин, аттацин, дрозоцин и мечниковин) и противогрибковые (Дрозомицин) пептиды.У личинок дикого типа все антимикробные гены сильно индуцируются после бактериального заражения. Напротив, у личинок, гомозиготных по либо ird5 , индукция диптерицин, цекропин А, дефенсин , дрозоцин или мечников в генах. Ген аттацина индуцируется у мутантов до ~ 30% нормальных уровней, в то время как дрозомицин индуцируется до нормальных уровней. Такие же эффекты на индукцию генов антимикробных пептидов наблюдаются в ird5 1 / Df и ird5 2 / Df животных, что предполагает что оба аллеля вызывают полную потерю функции гена (Lu, 2001).

    Мутации в трех других генах, imd, Relish и Связанный со смертью ced-3 / Nedd2-подобный белок , как было показано, предотвращает нормальную индукцию гены антибактериальных пептидов у взрослых дрозофил. Картина индукции гена антимикробного пептида у мутантов ird5 сравнивалась с таковой у мутантов imd и Relish как у личинок, так и у взрослых особей. Мутации во всех трех генах очень похожие эффекты на индукцию антимикробных генов у личинок: диптерицин и цекропин А не индуцируются; Индукция аттацина снижена, а индукция дрозомицина является нормальной.У взрослых животных фенотипы экспрессии антимикробных генов мутантов ird5 и Relish являются очень похоже: диптерицин индукция заблокирована, цекропин Индукция и аттацина снижена, и дрозомицин индукция в норме. Антимикробный ген Фенотип экспрессии imd взрослых немного отличается, с некоторой остаточной экспрессией диптерицина . Мутации в Dredd , каспаза дрозофилы, препятствует нормальной индукции диптерицина и аттацина и позволяют индукцию дрозомицин .Эти сравнения показывают, что ird5, Dredd , Смак и, вероятно, imd действуют в той же сигнализации путь контроля индукции антибактериальных пептидных генов в ответ на инфекцию (Lu, 2001).

    Оценить важность гена ird5 в контроле рост инвазивных бактерий, выживаемость и рост бактерий сравнивались у дикого типа ird5, imd и смакуют животных.У личинок дикого типа большая часть из E. coli , введенных животному, погибает через 6 часов после заражения. В этот же момент в 4-15 раз больше E. coli в ird5 мутантные личинки, как у животных дикого типа. Эффекты ird5 мутации более бросаются в глаза в экспериментах на взрослых: через 24 часа после заражения количество бактерий в организме увеличивается в 20-350 раз. животное на ird5 мутантов по сравнению с диким типом.Бактериальный фенотип роста мутантов ird5 аналогичен фенотипу, наблюдаемому у Смак мутантных личинок и взрослых особей, несколько сильнее, чем мутантов imd . Это согласуется с более сильным влиянием ird5 и Relish на гены антимикробных пептидов: мутации либо в ird5 , либо в Смак предотвращает нормальную индукцию диптерицина , цекропин, дрозоцин, аттацин и mechnikowin , а индукционный из mechnikowin индуцируется у мутантов imd (Lu, 2001).

    Мутации, ответственные за неспособность вызвать репортерный ген диптерицин-lacZ для обоих ird5 аллелей были картированы между видимыми маркерами у.е. (86Д1-4) и ср (90D2-F7) на правом плече третьей хромосомы. Дефицит Df (3R) sbd 45 (89B4-10) не дополняет иммунный дефект ответа либо аллеля ird5 . Дальше тесты на недостаточность комплементации и картирование мужской рекомбинации сузил интервал ird5 до 89B4-9, между корзиной и Stubble .Два молекулярно-определяемых гена в этот интервал рассматривались как кандидаты, ответственные за ird5 фенотип, Akt и ген, определенный EST, который относится к киназам IkappaB (IKK) млекопитающих. Мутантные аллели Akt вызывают рецессивную летальность, и ird5 / Akt [ l (3) 89Bq] гетерозиготных животных являются жизнеспособными и показали нормальную индукцию диптерицин-lacZ репортерный ген, указывающий на то, что ird5 фенотипы не вызваны мутациями в Akt (Lu, 2001).

    IKKbeta млекопитающих требуется для активации NF-kappaB в ответ на воспалительные сигналы, такие как TNF-альфа и IL-1; поэтому гомолог IKK рассматривался как ген-кандидат для ird5 . Полноразмерную кДНК клонировали для Гомолог IKK, обозначенный здесь DmIkkbeta . Тот же ген также идентифицирован на молекулярном уровне как кодирующий киназу, активируемую ЛПС. в линии клеток дрозофилы (Kim, 2000; Меджитов, 2000; Silverman, 2000). Основываясь на последовательности геномной ДНК, DmIkkbeta находится между pannier и мини-шпиндели .Два класса транскриптов, 2,7 и 4,2 т.п.н., были обнаружены из ген DmIkkbeta ; кДНК соответствует 2,7 т.п.н. стенограмма. Оба транскрипта экспрессируются на более высоких уровнях после инфекционное заболевание. В Полная открытая рамка считывания DmIkkbeta была секвенирована из хромосом ird5 1 и ird5 2 . Одиночная замена нуклеотидов C на T была обнаружена в ird5 1 , который изменит кодон глутамина (CAA) на аминокислота 266 открытой рамки считывания до стоп-кодона (ТАА) в пределах консервативный киназный домен.Никаких изменений последовательности не было идентифицирован в открытой рамке считывания в ird5 2 ; однако ни один транскрипт DmIkkbeta не был обнаружен в ird5 2 гомозигот. Этот анализ показывает что оба аллеля ird5 связаны с мутациями, которые следует отменить активность DmIkkbeta (Лу, 2001).

    Фенотип иммунного ответа ird5 демонстрирует поразительное специфичность: все гены антибактериальных пептидов сильно затронуты мутациями ird5 , но противогрибковый пептид ген дрозомицин обычно индуцируется у мутантов ird5 .Фенотип специфического иммунного ответа ird5 / DmIkkbeta в vivo контрастирует с глобальным воздействием на гены антимикробных пептидов наблюдается в клеточных линиях, когда доминирует отрицательная форма того же гена. экспрессируется в культивируемых клетках (Kim, 2000). В Фенотип мутанта ird5 / DmIkkbeta подразумевает, что in vivo, ird5 не является важным компонентом платной дороги, которая требуется для индукции дрозомицина . В ird5 / DmIkkbeta ген, следовательно, является компонентом независимый сигнальный путь, который может быть активирован другим член семейства Toll-подобных рецепторов дрозофилы (Lu, 2001).

    IKKalpha и IKKbeta млекопитающих фосфорилируют сериновые остатки в N-концевой домен IkappaB; эти остатки серина нацелены на расщепление IkappaB, тем самым позволяя ядерную локализацию и активацию NF-kappaB. В ird5 / DmIkkbeta предполагает, что белок, кодируемый этот ген фосфорилирует IkappaB-подобный белок. Есть два известных IkappaB-подобные белки дрозофилы, которые могут действовать как ингибитор белки иммунного ответа: кактус и С-концевой анкирин повторить домен Смак.В кактусах мутантов, дрозомицин экспрессируется конститутивно, а гены антибактериальных пептидов - нет, что указывает на то, что Кактус не участвует в путях, регулирующих антибактериальный пептидные гены. Кроме того, гомозиготный мутант ird5 / DmIkkbeta самки плодовиты, что свидетельствует о том, что этот ген не требуется для деградация Cactus во время формирования дорсально-вентрального паттерна у эмбриона (Lu, 2001).

    Фенотип ird5 / DmIkkbeta сходен с фенотипом из Смакуйте мутантов.Для обоих Гены гомозиготных мутантных мух жизнеспособны и плодовиты, что указывает на то, что эти два гена не являются необходимыми для развития. Мутации в любом Смак или ird5 / DmIkkbeta полностью предотвратить индукция диптерицина и цекропина , но позволяет индукция аттацина и дрозомицина . Мутации в любом из генов оказывают сравнимое влияние на рост бактерий. Эти результаты доказывают, что ird5 / DmIkkbeta и Relish действуют в том же сигнальном пути и предполагают, что Ird5 / DmIkkbeta активирует димеры, содержащие Relish.Активация Relish требует протеолитического расщепления белка Relish на N-концевой Relish. домен, который перемещается в ядро, и С-концевой анкириновый повтор домен, который остается в цитоплазме. Недавний биохимические эксперименты показали, что DmIkkbeta может фосфорилировать белок Relish (Silverman, 2000), что согласуется с модель, что фосфорилирование Relish с помощью DmIkkbeta ведет к целевому протеолизу и активации Relish (Lu, 2001).

    Хотя ird5 / DmIkkbeta экспрессируется матерински, мутантные самки ird5 являются фертильными, демонстрируя, что ген не требуется для формирования дорсально-вентрального паттерна эмбриона.Однако небольшая часть эмбрионов (~ 0,5%), произведенных гомозиготными ird5 1 или ird5 1 / ird5 2 самки демонстрируют фенотип со слабой дорсализацией, что позволяет предположить, что ird5 / DmIkkbeta действительно играет второстепенную роль в материнском пути, который активирует дорсальный путь. Предполагается, что в ранний эмбрион, который в первую очередь отвечает за фосфорилирование и деградация Кактуса. Нормальная индукция дрозомицина в ird5 / DmIkkbeta мутантов предполагает, что также будут другая киназа, активируемая путем Toll в иммунном ответ - возможно, та же киназа, которая действует ниже Toll по активировать спинной у эмбриона.Последовательность генома указывает на то, что есть является одним дополнительным геном киназы IkappaB у Drosophila. Будущее эксперименты проверит, играет ли этот ген роль в эмбриональных формирование паттерна и противогрибковый иммунный ответ (Lu, 2001).

    Полученные данные позволяют предположить, что разные димеры Rel Drosophila являются активируется гомологичными, но разными сигнальными путями. Учитывая сходство путей врожденного иммунного ответа у Drosophila и млекопитающих, вполне вероятно, что сходные компоненты передачи сигналов, специфичные для пути, будут опосредовать активности членов Rel белков млекопитающих (Lu, 2001).

    Иммунная активация NF-kappaB и JNK требует TAK1 дрозофилы

    Стимуляция иммунного ответа дрозофилы активирует сигнальные пути NF-kappaB и JNK. Например, инфицирование грамотрицательными бактериями индуцирует сигнальный путь Imd, что приводит к активации NF-kappaB-подобного фактора транскрипции Relish и экспрессии батареи генов, кодирующих антимикробные пептиды. Бактериальная инфекция также активирует путь JNK, но роль этого пути в иммунном ответе еще не установлена.Генетические эксперименты предполагают, что гомолог Drosophila киназы киназы MAPK млекопитающих, TAK1 (альфа-активированная киназа 1 трансформирующего фактора роста), активирует пути JNK и NF-kappaB после иммунной стимуляции. Этот отчет демонстрирует, что TAK1 дрозофилы функционирует как киназа, активирующая киназу Drosophila IkappaB, так и как киназа, активирующая киназу JNK. Однако это исследование показало, что передача сигналов JNK не требуется для экспрессии гена антимикробного пептида, но необходима для активации других иммунно-индуцируемых генов, включая Punch , сульфатированный ) и malvolio .Таким образом, передача сигналов JNK, по-видимому, играет важную роль в клеточном иммунном ответе и ответе на стресс (Silverman, 2003).

    Врожденные иммунные сигнальные пути высоко консервативны между насекомыми и млекопитающими. В обоих случаях патогены распознаются путем обнаружения консервативных молекул, таких как компоненты микробной клеточной стенки, которые являются общими для широких групп микробов. Например, липополисахариды (ЛПС) грамотрицательных бактерий являются мощными индукторами врожденного иммунитета как насекомых, так и млекопитающих.ЛПС и другие микробные вещества распознаются рецепторами, кодируемыми зародышевой линией, такими как Toll-подобные рецепторы (TLR) или белки распознавания пептидогликана. Активация этих рецепторов стимулирует консервативные сигнальные пути, ведущие к экспрессии антимикробных белков и иммуностимулирующих цитокинов. Например, обработка LPS приводит к активации сигнальных путей NF-kappaB и c-Jun N-терминальной киназы (JNK) как у насекомых, так и у млекопитающих. У млекопитающих путь NF-kappaB необходим для индукции цитокинов в ответ на инфекцию.Аналогичным образом, у мухи Relish требуется гомолог NF-kappaB для индукции антимикробных пептидов в ответ на грамотрицательную бактериальную инфекцию, а relish мутанты гиперчувствительны к грамотрицательным бактериальным инфекциям (Silverman, 2003).

    Relish - это двудольный белок с доменом NF-kappaB (Rel homology) и ингибирующим доменом IkappaB. В нестимулированных клетках Relish присутствует в цитоплазме в виде полноразмерного белка-предшественника и при инфицировании эндопротеолитически расщепляется.N-концевой домен гомологии Rel Relish затем перемещается в ядро ​​и активирует экспрессию антимикробного гена, тогда как C-концевой модуль IkappaB остается в цитоплазме. Сигнально-индуцированное расщепление и активация Relish требует сигнального пути, известного как путь Imd, который включает рецептор PGRP-LC (белок распознавания пептидогликана LC), внутриклеточный сигнальный компонент IMD (белок домена смерти, подобный белку, взаимодействующему с рецептором (RIP). ), TAK1 (MAP3K), IKK-комплекс Drosophila (IKKβ / ird5 и IKKγ / kenny ), а также каспаза Dredd и адаптер, известный как Fas-связанный домен смерти (FADD). необходимые для этого внутриклеточного сигнального пути не изучены (Silverman, 2003).

    Другой консервативной иммунной сигнальной системой является путь JNK. Активация сигнальных путей JNK (и др. MAPK) в передаче сигналов врожденного иммунитета хорошо документирована у позвоночных. Три сигнальных пути MAPK (JNK, ERK и p38) стимулируются обработкой LPS. Фармакологическое ингибирование путей ERK и / или p38 в клеточных линиях моноцитов подавляет индукцию цитокинов, таких как IL-1, IL-8 и фактор некроза опухоли α (TNFα). Кроме того, в эмбриональных фибробластах мыши JNK2 необходим для индукции интерферонов типа I в ответ на вирусную инфекцию и для индукции IL-12 и IL-6 в ответ на LPS.Хотя все члены пути JNK законсервированы у мух и передача сигналов JNK дрозофилы активируется в ответ на стимуляцию LPS, роль этого пути в иммунных ответах насекомых четко не очерчена (Silverman, 2003).

    Напротив, роль пути передачи сигналов JNK в развитии Drosophila была тщательно изучена. Наилучшим образом понятна роль передачи сигналов JNK в дорсальном закрытии во время эмбрионального развития. Каскад киназ дорсального замыкания JNK-пути основан на киназе MAP3K типа MAP3K ( slpr ), которая, как полагают, функционирует как киназа JNKK, активируя киназу JNK гемиптеросом (hep ), , в свою очередь, активирует корзину JNK (bsk ).Bsk, в свою очередь, фосфорилирует и активирует фактор транскрипции d-Jun (Silverman, 2003).

    Дорсальное закрытие механически похоже на заживление ран. Оба процесса включают протягивание эпителиального листа через отверстие и его герметизацию. Недавно было высказано предположение, что передача сигналов JNK необходима для заживления ран у мух. В соответствии с этой идеей, сообщалось, что мишени передачи сигналов JNK во время иммунной активации включают многие цитоскелетные компоненты, подобные тем, которые, как сообщается, являются JNK-индуцибельными генами во время дорсального закрытия.Хотя это разумная гипотеза, еще не было продемонстрировано, что ингибирование передачи сигналов JNK, например, путем инактивации bsk или hep , препятствует правильному заживлению ран. Помимо своей потенциальной роли в заживлении ран, передача сигналов JNK дрозофилы также участвует в активации стресс-защитных белков. Кроме того, в более ранних сообщениях предполагалось, что AP-1-подобные факторы транскрипции, которые являются конечными мишенями сигнального пути JNK, могут регулировать экспрессию гена антимикробного пептида.Т.о., JNK может действовать на многих разных уровнях иммунного ответа дрозофилы, но выяснилось несколько механистических деталей (Silverman, 2003).

    У млекопитающих MAP3K TAK1 играет центральную роль в путях передачи сигналов IL-1R / Toll-подобного рецептора. Биохимические исследования in vitro показали, что TAK1 может быть активирован непосредственно фактором 6, ассоциированным с рецептором фактора некроза опухоли (TRAF6), который, как известно, является критическим компонентом этого сигнального пути. Более того, эти in vitro исследования продемонстрировали, что после активации TAK1 может активировать как комплекс IKK (и передачу сигналов NF-kappaB), так и JNKK MKK6 (и передачу сигналов JNK) (Wang, 2001).Недавние исследования на культуре клеток млекопитающих продемонстрировали, что TAK1 необходим для активации NF-kappaB после стимуляции фактора некроза опухоли альфа или IL-1 (Takaesu, 2003). Сходным образом TAK1 дрозофилы необходим для сигнального пути Imd; Мухи Drosophila TAK1 - / - обладают сильно нарушенным иммунным ответом и не экспрессируют антимикробные пептиды при заражении грамотрицательными бактериями (Vital, 2001). Кроме того, эксперименты по профилированию экспрессии генов подразумевают, что Drosophila TAK1 отвечает за активацию передачи сигналов как JNK, так и NF-kappaB (Relish) после иммунной стимуляции (Butros, 2002).Однако эти исследования не предоставляют биохимических данных, подтверждающих эту гипотезу (Silverman, 2003).

    В этом отчете использовались клетки S2 * дрозофилы, чтобы показать, что TAK1 необходим как для LPS-индуцированной активации JNK, так и для IKK, а также для индукции гена антимикробного пептида. Удивительно, но иммунная активация пути JNK не требуется для индукции гена антимикробного пептида. Однако несколько других JNK-зависимых, LPS-индуцируемых генов были идентифицированы в исследованиях микроматриц, предполагая роль передачи сигналов JNK в клеточном иммунном ответе, а также в защите от стресса (Silverman, 2003).

    Это исследование показало, что белок TAK1 дрозофилы играет решающую роль в активации иммунного ответа насекомых. Генетические исследования показали, что TAK1 мутантных мух неспособны отвечать на грамотрицательные инфекции, и предположили, что TAK1 функционирует выше комплекса IKK дрозофилы (Vidal, 2001). В соответствии с этими результатами, это исследование показывает, что TAK1 необходим для активации LPS-индуцированных иммунных сигнальных путей в клетках дрозофилы в культуре.Кроме того, TAK1 необходим для активации IKK комплекса дрозофилы in vitro . Т.о., Drosophila TAK1, вероятно, функционирует как IKK-K в пути передачи сигналов LPS, как было предложено для TAK1 человека (Silverman, 2003).

    Передача сигналов JNK также активируется во время иммунного ответа как у мух, так и у людей. Однако точный механизм, с помощью которого LPS приводит к активации JNK у Drosophila, неясен, как и роль передачи сигналов JNK во время иммунного ответа.Boutros (2002) использовал профили экспрессии генов, чтобы сделать вывод, что TAK1 необходим для активации передачи сигналов JNK и что передача сигналов JNK важна для заживления ран. Это исследование напрямую продемонстрировало, что для активации JNK требуется TAK1. Таким образом, TAK1, по-видимому, функционирует и как активирующая JNKK киназа, и как активирующая IKK киназа, как предполагается для TAK1 млекопитающих (Wang, 2001). Более того, результаты микроматрицы предполагают, что передача сигналов JNK может иметь важные функции в клеточном иммунитете и ответной реакции на стресс (Silverman, 2003).

    Данные профилирования экспрессии генов, представленные в этом исследовании, идентифицируют относительно небольшое количество генов, которые специфически нуждаются в сигнальном пути JNK для их LPS-индуцированной экспрессии. Экспрессия двух генов ( Punch и сульфатированный ), идентифицированных в этих экспериментах, была подтверждена с помощью ОТ-ПЦР в реальном времени. Punch представляет собой иммунно-индуцируемый ген в клетках в культуре, как показано в этом исследовании, и во взрослых мухах, как показано Де Грегорио (2001).Однако это исследование показало, что у взрослых мух для иммунной индукции Punch требуется Relish, тогда как данные, представленные в этом исследовании, демонстрируют, что для индукции Punch в клетках S2 * необходимы компоненты пути JNK ( hep, bsk и TAK1 ), но не активирующую Relish киназу IKK. Эксперименты, представленные в этом исследовании, проводились на эмбриональной клеточной линии дрозофилы (которая имеет свойства макрофагов), тогда как данные Де Грегорио были получены на целых взрослых особях мух.Таким образом, возможно, что сигнальные пути, необходимые для индукции Punch , варьируются в зависимости от стадии развития и типа исследуемых клеток. Фактически, Punch имеет по крайней мере два промотора (McLean, 1993), которые направляют экспрессию, специфичную для развития (Silverman, 2003).

    Punch кодирует фермент GTP циклогидролазы I, который является первым ферментом (и этапом, определяющим скорость) в образовании кофактора тетрагидробиоптерина (Bh5).Этот кофактор необходим для превращения тирозина в дофамин, который играет по крайней мере две возможные роли в иммунитете. Во-первых, дофамин является одним из двух основных катехоламинов дрозофилы, которые важны для реакции на стресс как у насекомых, так и у млекопитающих. Во-вторых, дофамин является предшественником меланина, который вырабатывается во время процессов заживления ран и инкапсуляции у мух. Фактически, было высказано предположение, что повышенная активность Punch может привести к усилению меланизации (Silverman, 2003).

    Кофактор Bh5 также является важным кофактором синтазы оксида азота (NOS). NO сам по себе играет по крайней мере две возможные роли в иммунном ответе. Во-первых, известно, что NO является основным микробицидным соединением в фагоцитарных клетках млекопитающих и, вероятно, аналогичным образом действует в макрофагах Drosophila. Во-вторых, NO также участвует в передаче иммунных сигналов у Drosophila. Foley (2003) недавно сообщил, что NO необходим для передачи сигнала от места инфекции к жировому телу, главному органу экспрессии иммунных генов.Таким образом, Punch может способствовать иммунному ответу насекомых несколькими способами, включая защиту от стресса, меланизацию участков ран и активацию клеточного и гуморального иммунитета (Silverman, 2003).

    Потенциальная роль сульфатированного в иммунном ответе менее очевидна. сульфатированный кодирует внеклеточную сульфатазу, которая удаляет сульфатные группы из протеогликанов сульфата гепарина (HSPG). В системах птиц и дрозофилы считается, что активность сульфатированного является критической для регуляции передачи сигналов Wnt, возможно, за счет контроля внеклеточной среды, в которой перемещается лиганд Wnt (Silverman, 2003).

    Одной из наиболее интересных мишеней путей JNK и IKK является Mvl , гомолог NRAMP-1 дрозофилы. Mvl мутанты были впервые идентифицированы на лету, потому что они обнаруживают дефекты вкусового поведения, вызванные неспособностью должным образом обрабатывать сенсорный ввод нейронов (Rodrigues, 1995). Mvl экспрессируется как в нервной системе, так и в циркулирующих гемоцитах. У мышей NRAMP-1 экспрессируется в макрофагах, а мутации в гене NRAMP-1 ответственны за чувствительность некоторых инбредных линий мышей к Mycobacterium bovis бацилле Кальметта-Герена (BCG) и другим внутриклеточным бактериальным патогенам.Считается, что NRAMP-1 контролирует уровни катионов, возможно, Fe 2+ или Mn 2+ , в лизосомных компартментах макрофагов мыши. Текущая модель предполагает, что NRAMP-1 выкачивает катионы из фаголизосомы, тем самым лишая микробы катионов, необходимых для ферментов (супероксиддисмутазы и каталазы), которые защищают бактерии от реактивного промежуточного соединения кислорода (ROI) и реактивного промежуточного соединения азота (RNI). -индуцированное повреждение (Nelson, 1999). У мух роль Mvl в иммунитете еще не охарактеризована, но его индукция во время иммунного ответа в сочетании с активностью этого белка в макрофагах позвоночных предполагает, что он может играть важную роль в клеточном иммунном ответе (Silverman, 2003). .

    Недавнее исследование на микроматрицах предоставило доказательства того, что LPS-индуцированная активация JNK важна для стимуляции программы экспрессии генов, аналогичной той, что наблюдается во время дорсального закрытия. Таким образом, JNK может иметь важное значение для заживления ран. В этом исследовании сообщалось только о нескольких генах-мишенях JNK (например, Filamin ). Вместо этого это исследование выявило ряд генов, участвующих в межклеточных взаимодействиях, стрессовых ответах и ​​активации макрофагов. Различия между этими исследованиями могут быть следствием одной или нескольких из следующих причин.Во-первых, эксперименты Бутроса (2002) нацелены на два MAP2K (Hep и dMKK4) с помощью РНКи. Как показано в биохимических данных, представленных в этом исследовании, Drosophila JNKK ( hep ) отвечает за LPS-индуцированное фосфорилирование c-Jun. Таким образом, вероятно, что в экспериментах Бутроса были ингибированы дополнительные пути MAPK. Во-вторых, клетки S2 *, обработанные экдизоном, использовали вместо недифференцированных клеток S2. Лечение экдизоном вызывает значительные изменения в клетках S2 *, включая изменение морфологии и адгезии, остановку клеточного цикла и, что наиболее важно, более высокий уровень экспрессии гена антимикробного пептида, индуцированного ЛПС.Кроме того, в текущих экспериментах использовались напечатанные массивы кДНК, которые включают только ~ 40% предсказанных генов на лету, тогда как Бутрос использовал массивы на основе олигонуклеотидов, которые включают признаки для всех ~ 14 000 предсказанных генов. Следовательно, данные утверждают, что передача сигналов JNK необходима для активации клеточного иммунитета и защиты от стресса, тогда как связь с заживлением ран не может быть исключена текущими данными (Silverman, 2003).

    Более ранние исследования показали, что определенные антимикробные гены ( e.грамм. диптерицин ) требуют комбинации факторов транскрипции для их правильной индукции. Было высказано предположение, что на основе отпечатков ДНК и анализа последовательности ДНК, для активации диптерицина требуется сайт связывания kappaB (который теперь считается сайтом связывания Relish), а также предполагаемый NF-IL6-подобный и регуляторный фактор интерферона (IRF) вроде сайтов привязки. Однако в последнее десятилетие исследований было установлено, что только Relish необходим для иммуно-индуцируемой экспрессии диптерицина .Данные, представленные в этом исследовании, показывают, что путь передачи сигналов JNK и AP-1-подобные факторы, активируемые передачей сигналов JNK дрозофилы, не участвуют в индукции гена антимикробного пептида в фагоцитах. Это будет сильно отличаться от иммунной активации многих генов цитокинов млекопитающих, которая требует координации нескольких сигнальных путей и активности нескольких факторов транскрипции для полной иммунной индукции. Например, для индукции IFN-гамма требуется активация трех независимых сигнальных каскадов и кооперативное связывание трех факторов транскрипции, NF-kappaB, c-Jun / активирующего фактора транскрипции 2 (ATF-2) и фактора регуляции интерферона, с энхансерная область.Вместе эти факторы транскрипции образуют комплекс более высокого порядка, известный как энхансома. Контроль антимикробных генов насекомых может не потребовать этой сложной архитектуры энхансера (Silverman, 2003).

    Эти исследования ясно демонстрируют, что активация врожденного иммунного ответа у Drosophila приводит к активации сигнальных путей JNK и NF-kappaB через разветвленный каскад передачи сигнала. MAP3K TAK1 находится в точке ветвления этого каскада и, вероятно, функционирует как активирующая киназа JNKK и активирующая киназа IKK.Эти сигнальные пути очень консервативны. TAK1 также выполняет сходные функции в передаче сигналов врожденного иммунитета млекопитающих. Кроме того, были идентифицированы новые иммуно-индуцированные мишени пути JNK, которые могут функционировать в клеточном иммунитете и защите от стресса (Silverman, 2003).

    Опосредованный каспазой процессинг фактора NF-kappaB дрозофилы Relish

    NF-κB-подобный фактор транскрипции Relish играет центральную роль во врожденном иммунном ответе дрозофилы.В отличие от других белков NF-κB, Relish активируется эндопротеолитическим расщеплением с образованием ДНК-связывающего домена гомологии Rel и стабильного IκB-подобного фрагмента. Этот индуцированный сигналом эндопротеолиз требует активности нескольких генных продуктов, включая киназный комплекс IκB и каспазу Dredd. В этом исследовании использовался мутационный анализ и микросеквенирование белков, чтобы продемонстрировать, что сайт-мишень каспазы, расположенный в линкерной области между Rel и IκB-подобным доменом, является сайтом зависимого от сигнала расщепления.Показано физическое взаимодействие между Relish и Dredd, что позволяет предположить, что Dredd действительно является эндопротеазой Relish. Помимо сайта-мишени каспазы, 107 аминокислотных остатков С-конца Relish необходимы для эндопротеолиза и сигнально-зависимого фосфорилирования с помощью киназы IκB β дрозофилы. Наконец, было обнаружено, что N-концевой богатый серином регион в Relish и в домене PEST негативно регулируют активацию Relish (Stöven, 2003).

    Врожденные иммунные ответы зависят от факторов транскрипции семейства Rel / NF-κB.В нестимулированных клетках белки Rel находятся в цитоплазме в комплексе с ингибирующей молекулой IκB. После иммунного заражения ингибитор фосфорилируется комплексом киназы IκB (IKK), убиквитинируется и разрушается протеасомой 26S. Освободившийся белок Rel перемещается в ядро, где активирует гены-мишени. Сигнальные каскады, активирующие белки Rel, очень консервативны между мухами и человеком. Многие белки, участвующие в пути рецептора фактора некроза опухоли млекопитающих, имеют близкие гомологи в пути иммунодефицита ( imd ) Drosophila , который контролирует иммуно-индуцированное производство антимикробных пептидов.Недавние генетические исследования установили порядок, в котором участвующие гены могут действовать в этом сигнальном пути. Центральным фактором транскрипции в сигнальном каскаде imd является фактор NF-κB Relish. Благодаря своей сложной структуре, включающей домен гомологии Rel и IκB-подобный домен, Relish подобен предшественникам NF-κB p100 и p105 млекопитающих (Stöven, 2003).

    Но в отличие от его аналогов у млекопитающих, активация Relish не требует протеасомозависимой деградации IκB-подобной области.Вместо этого Relish обрабатывается быстрым сигнально-зависимым эндопротеолизом, генерируя два стабильных фрагмента: REL-68, который содержит домен гомологии Rel и перемещается в ядро, и REL-49, который включает IκB-подобную область и остается цитоплазматическим. Неожиданно на роль каспазы в активации Relish указывал тот факт, что мутанты в Dredd , гене каспазы дрозофилы, испытывают недостаток в процессинге Relish и продукции антимикробных пептидов. Но вопрос о том, действует ли Дредд непосредственно на Relish, оставался открытым (Stöven, 2003).

    Комплекс IKK дрозофилы также регулирует процессинг приправы. Комплекс IKK активируется иммунной стимуляцией, и IKKβ дрозофилы может непосредственно фосфорилировать Relish in vitro (Silverman, 2000). Более того, мутанты ird5 (IKKβ) и kenny (IKKγ) имеют тот же иммунный фенотип, что и мутанты Relish (Lu, 2001; Rutschmann, 2000). Однако неясно, происходит ли IKKβ-опосредованное фосфорилирование Relish в ответ на иммунный стимул и требуется ли оно для расщепления Relish in vivo (Stöven, 2003).

    Это исследование дополнительно исследовало роль Dredd и IKKβ в расщеплении Relish и охарактеризовало те последовательности в Relish, которые необходимы для его эндопротеолиза. Сообщается о фактическом сайте расщепления, а также о прямых взаимодействиях между Dredd и Relish; вместе эта информация предоставляет убедительные доказательства того, что эндопротеолиз Relish действительно осуществляется каспазой Dredd (Stöven, 2003).

    Представленные здесь данные демонстрируют, что зависимое от сигнала расщепление Relish происходит в целевом сайте каспазы.Остатки, непосредственно примыкающие к сайту расщепления, соответствуют консенсусу каспаз, и критический аспартат в этом сайте в положении 545 требуется для расщепления. Эти данные убедительно свидетельствуют о том, что каспаза является эндопротеазой Relish. Хотя Дредд, по гомологии с человеческими каспазами-8 и -10, считается скорее инициатором, чем эффекторной каспазой, он является основным кандидатом на роль эндопротеазы Relish. Dredd мутанты не могут обрабатывать Relish. Это исследование показало, что Дредд и Релиш взаимодействуют физически.Более того, ни одна из шести других известных каспаз дрозофилы не участвовала в активации Relish, когда в культуре клеток использовалась интерференция РНК. Однако до сих пор не удалось восстановить расщепление in vitro с помощью очищенного Dredd и IKKβ-фосфорилированного Relish (Stöven, 2003).

    Дредд и Релиш связаны друг с другом перед иммунным стимулом, что свидетельствует о существовании предварительно собранного комплекса Дредд / Релиш, который ожидает входящего сигнала.Этот сигнал, скорее всего, идентичен фосфорилированию IKKβ. Эта установка хорошо согласуется со скоростью обработки Relish, которая происходит в течение нескольких секунд после стимуляции LPS (Stöven, 2003).

    Это исследование выявило дополнительные области в Relish, которые контролируют его активацию. N-концевой участок, богатый серином, и домен PEST, по-видимому, негативно регулируют активацию Relish. Одной из привлекательных моделей активации Relish является то, что предшественник удерживается в закрытой конформации за счет взаимодействия между богатой серином областью и доменом PEST.Эта закрытая конформация будет предотвращать ядерную транслокацию, несоответствующее расщепление и связывание ДНК за счет сокрытия сигнала ядерной локализации и плохо структурированного линкера с сайтом-мишенью каспазы. При стимуляции Relish фосфорилируется в реакции, которая требует IKKβ и 107 С-концевых остатков Relish. Эта модификация приводит к открытой конформации, в которой становятся доступными сигнал ядерной локализации и сайт-мишень каспазы (Stöven, 2003).

    Прямое участие каспазы в эндопротеолизе Relish представляет собой новый механизм активации NF-κB и функции каспазы.Интересно, что аналогичный механизм может существовать и в системах млекопитающих. Например, мутация потери функции каспазы-8 у людей связана с дефектной активацией лимфоцитов, процесс, который, как известно, требует NF-κB. Эта новая функция каспазы-8 не зависит от передачи сигналов рецептора смерти и индукции апоптоза. Еще одна параллель между процессингом Relish и активацией NF-κB у млекопитающих заключается в так называемом неканоническом пути NF-κB, который требует, чтобы киназа, индуцирующая NF-κB, и IKK для сигнально-зависимого процессинга p100 (Stöven, 2003 и ссылки в нем) .

    Заражение дрозофилы грамотрицательными бактериями запускает путь передачи сигнала (путь IMD), завершающийся экспрессией генов, кодирующих антимикробные пептиды. Ключевым компонентом этого пути является комплекс киназы IkappaB дрозофилы (DmIKK), который стимулирует расщепление и активацию фактора транскрипции NF-kappaB Relish. Комплекс IKK состоит из киназы Drosophila IkappaB [состоящей из 2 субъединиц: субъединицы каталитической киназы, кодируемой ird5 (IKKβ), и регуляторной субъединицы, кодируемой кенни (IKKγ)].Для активации комплекса DmIKK необходим MAP3K dTAK1, но механизм активации dTAK1 не изучен. В клетках человека для активации TAK1 и IKK требуются человеческие убиквитин-конъюгированные ферменты Ubc13 и UEV1a. Это исследование демонстрирует, что гомологи Ubc13 дрозофилы (Bendless) и UEV1a аналогичным образом необходимы для активации dTAK1 и комплекса DmIKK. Удивительно, но каспаза DREDD дрозофилы и ее партнер dFADD необходимы для активации DmIKK и JNK в дополнение к их роли в расщеплении Relish.Эти исследования показывают эволюционно консервативную роль убиквитинирования в активации IKK и предоставляют новое понимание иерархии сигнальных компонентов в пути антибактериального иммунитета дрозофилы (Zhou, 2005).

    Система клеточных культур была создана для изучения путей передачи сигналов IMD и Toll в клетках S2. Путь IMD активируется обработкой клеток грамотрицательным пептидогликаном (который присутствует в сырых препаратах липополисахаридов), тогда как активация пути Toll достигается обработкой клеток лигандом Spätzle.Активный Spätzle продуцируется из линии клеток, стабильно трансфицированной плазмидой, содержащей индуцируемый медью промотор металлотионеина , управляющий экспрессией активного Spätzle C-106. Когда эти клетки обрабатывают медью, активная SPZ секретируется в среду, и эту кондиционированную среду можно использовать для активации наивных клеток. Используя метод РНКи-опосредованной инактивации гена, было обнаружено, что SPZ-индуцированная активация гена дрозомицина в клетках S2 требует, как и ожидалось, белков Rel Drosophila, Dif и Dorsal, а также Toll, dMyD88, Tube, Pelle и Slimb.Напротив, эти дцРНК не блокируют экспрессию генов антимикробных пептидов, индуцированную пептидогликаном. Вместо этого исследования РНКи демонстрируют, что экспрессия генов, индуцированная пептидогликаном, требует всех известных компонентов пути IMD. Следовательно, этот подход RNAi был использован для определения ролей кандидатных сигнальных компонентов в сигнальных путях IMD и Toll (Zhou, 2005).

    Предыдущие исследования показали, что активация комплекса IKK млекопитающих требует стадии убиквитинирования.В частности, было показано, что для активации IKK, опосредованной TRAF6, требуется димерный убиквитин-конъюгированный фермент, состоящий из белков Ubc13 и UEV1a. Bendless и dUEV1a являются гомологами Ubc13 и UEV1a у дрозофилы соответственно. Bendless и dUEV1a, как и их аналоги из млекопитающих, ассоциируют друг с другом in vivo . Чтобы исследовать, требуются ли Bendless и dUEV1a для экспрессии антибактериальных генов в ответ на пептидогликан, был использован метод инактивации генов, опосредованный РНКи.Клетки S2 трансфицировали различными дцРНК. Через 48 часов клетки сначала обрабатывали 20-гидроксиэкдизоном в течение 24 часов, чтобы повысить их способность индуцировать антимикробные гены в ответ на иммунную стимуляцию, а затем обрабатывали пептидогликаном или SPZ для активации сигнальных путей IMD или Toll соответственно. Тотальную РНК выделяли из этих клеток и подвергали Нозерн-блоттингу с использованием фрагментов кДНК, соответствующих диптерицину или дрозомицину в качестве зондов, для исследования активации IMD и Toll путей соответственно.И Bendless, и dUEV1a необходимы для максимальных уровней экспрессии гена антибактериального пептида в ответ на лечение пептидогликаном. Фактически, когда и Bendless, и dUEV1a нацелены на РНКи, индукция диптерицина снижается до уровня, близкого к фоновому. (Частичный эффект только РНКи Bendless или dUEV1a, вероятно, связан с тем фактом, что РНКи часто не генерирует полный нулевой фенотип.) Напротив, индукция дрозомицина активацией Toll не зависит от опосредованного РНКи нокдауна. из Bendless и dUEV1a .Обратите внимание, что одни и те же клетки стимулировали либо пептидогликаном, либо SPZ in. В качестве контроля клетки S2, обработанные дцРНК DmIKK γ (Kenny) или Toll , показали значительное снижение индуцированного пептидогликаном диптерицина или SPZ-индуцированного дрозомицина экспрессия генов соответственно. В качестве контроля уровни мРНК и / или белка целевых генов исследовали с помощью ОТ-ПЦР и / или вестерн-блоттинга для подтверждения эффективности РНКи (Zhou, 2005).

    Для получения дополнительных доказательств того, что Bendless участвует в пути IMD, был использован доминантно-отрицательный мутант Bendless для определения того, может ли быть заблокирована индуцированная пептидогликаном активация антибактериального гена.Были получены стабильные клеточные линии S2, которые экспрессируют либо дикого типа, либо C87A Bendless под контролем промотора металлотионеина . Мутация цистеина в аланин в положении 87 создает доминантно-отрицательный мутант, потому что этот остаток, расположенный в каталитическом кармане убиквитин-конъюгированных ферментов, имеет решающее значение для каталитической активности E2s. Затем эти клетки обрабатывали различными комбинациями пептидогликана и меди, и нозерн-блоттинг применяли для исследования экспрессии антибактериальных генов, включая аттацин, цекропин и диптерицин .Сверхэкспрессия Bendless дикого типа не влияет на вызванную пептидогликаном активацию антибактериального гена, поскольку аналогичные уровни экспрессии гена антибактериального пептида были обнаружены в клетках, обработанных медью или без нее. Напротив, избыточная экспрессия Bendless C87A приводит к значительному снижению активируемой пептидогликаном экспрессии антибактериальных пептидных генов (Zhou, 2005).

    Было идентифицировано бесхитростных мух, которые переносят замену пролина на серин в положении 97 в строго консервативной области активного сайта E2s.Для того чтобы определить, являются ли бесхарактерных мух дефектными в ответ на грамотрицательную бактериальную инфекцию, мух дикого типа и бесхитростных мух были подвергнуты заражению E. coli , а активация гена диптерицина была исследована с помощью Нозерн-блоттинга. без изгиба мух демонстрируют значительно более слабую активацию гена диптерицина по сравнению с мухами дикого типа. Эти результаты показывают, что комплекс Bendless-dUEV1a E2 необходим для передачи сигналов по пути IMD (Zhou, 2005).

    Были проведены эксперименты, чтобы определить, требуются ли Bendless и dUEV1a для индуцированной пептидогликаном активации комплекса DmIKK. Предыдущие исследования показали, что обработка пептидогликаном индуцирует киназную активность эндогенного комплекса DmIKK в клетках S2. Клетки трансфицировали дцРНК, соответствующими различным мРНК. Через 48 часов эти клетки обрабатывали пептидогликаном в течение 15 минут, эндогенный комплекс DmIKK подвергали иммунопреципитации и подвергали киназным анализам in vitro с использованием рекомбинантного белка Relish в качестве субстрата. Bendless или dUEV1a Обработка dsRNA приводит к значительному снижению индуцированной пептидогликаном активности киназы DmIKK, предполагая, что Bendless и dUEV1a необходимы для индуцированной пептидогликаном активации DmIKK. В качестве контроля обработка DmIKK γ-дцРНК полностью устраняла индуцированную пептидогликаном активацию DmIKK. Сделан вывод, что убиквитин-конъюгирующие ферменты Bendless и dUEV1a специфически участвуют в пути IMD у дрозофилы, и они играют роль выше комплекса DmIKK (Zhou, 2005).

    Сверхэкспрессия IMD у Drosophila приводит к активации антибактериальных генов в отсутствие бактериальной инфекции. Сверхэкспрессия IMD под контролем индуцируемого медью промотора металлотионеина может также сильно активировать экспрессию гена диптерицина в клетках S2. Эта стабильная клеточная линия, таким образом, представляет собой полезный инструмент для выполнения эпистатического анализа для определения положения комплекса Bendless / dUEV1a относительно IMD в антибактериальном сигнальном пути дрозофилы.Стабильные IMD клетки сначала трансфицировали дцРНК, происходящими из различных генов, а затем стимулировали медью или пептидогликаном, и исследовали активацию гена диптерицина , индуцированную IMD и пептидогликаном. Сверхэкспрессия IMD за счет добавления меди приводит к сильной активации гена диптерицина . Фактически, индуцированная медью экспрессия IMD так же эффективна, как и пептидогликан, в управлении экспрессией диптерицина. Клетки, трансфицированные дцРНК LacZ , демонстрируют аналогичный профиль экспрессии диптерицина по сравнению с клетками, которые подвергались ложной обработке.В соответствии с наблюдением, что комплекс DmIKK функционирует ниже IMD, клетки, трансфицированные дцРНК DmIKK γ, имеют серьезные дефекты в отношении индуцированной IMD и пептидогликаном экспрессии диптерицина . Кроме того, клетки, обработанные дцРНК, происходящими из генов Bendless и dUEV1a , демонстрируют значительное снижение как опосредованной пептидогликаном, так и IMD-опосредованной активации гена диптерицина . Эти результаты показывают, что конъюгирующие с убиквитином ферменты Bendless и dUEV1a действуют ниже IMD в этом сигнальном пути (Zhou, 2005).

    Таким образом, путем дифференциальной активации сигнальных путей IMD и Toll в клетках S2 дрозофилы это исследование показывает, что Bendless (dUbc13) и dUEV1a необходимы для сигнального пути IMD дрозофилы. Использование РНКи для нацеливания на Bendless и / или dUEV1a значительно снижает уровни экспрессии гена антибактериального пептида, индуцированной пептидогликаном, и активацию комплекса IKK дрозофилы. Этот механизм активации IKK очень консервативен; у млекопитающих Ubc13 и UEV1a необходимы для TNFalpha-, IL-1β- и TCR-опосредованной активации IKK и NF-kappaB (Zhou, 2005).

    Эта активация убиквитин-зависимой киназы не включает деградацию, опосредованную протеасомами. Ингибиторы протеасом не блокируют активацию IKK ни у мух, ни у людей. Более того, было показано, что убиквитинирование без деградации активирует комплекс IKK человека, и была идентифицирована аналогичная активность дрозофилы. Первичная последовательность Ubc13 / UEV1a млекопитающих и последовательности Drosophila Bendless / dUEV1a высококонсервативны (90% сходства для Ubc13 , 79% для UEV1a).Кристаллические структуры дрожжевого и человеческого Ubc13 / UEV1a (Mms2) ясно показали, что этот комплекс E2 может образовывать только полиубиквитиновые цепи, связанные с K63. Т.о., вероятно, что Drosophila Bendless / dUEV1a E2 катализирует образование K63-связанных цепей убиквитина (Zhou, 2005).

    Было показано, что в бесклеточной системе человеческий TRAF6 является лигазой E3, которая аутоубиквитинирует вместе с Ubc13 / UEV1a. Это приводит к активации TRAF6 и, в свою очередь, к активации TAK1.Активированный TAK1 фосфорилирует ключевые остатки серина в петле активации IKKβ, что приводит к активации IKKβ. Предполагается, что сходные механизмы задействованы в пути IMD у дрозофилы. Это исследование демонстрирует, что гомолог TAK1 дрозофилы функционирует ниже Bendless и dUEV1a. Кроме того, для пути IMD также необходим гомолог TAB2 / TAB3 у дрозофилы. Интересно, что C-концевой домен цинкового пальца TAB2, который консервативен в белке Drosophila, как недавно было показано, специфически связывается с цепями K63-polyubiquitin.Поразительно, но было обнаружено, что мутант galere / dTAB2, дефектный по пути IMD, несет мутацию в этом домене цинкового пальца (Zhou, 2005).

    Лигаза E3 дрозофилы, аналогичная человеческому TRAF2 или TRAF6, которая действует с Bendless и dUEV1a в активации dTAK1 и DmIKK, еще предстоит идентифицировать. У дрозофилы белок dTRAF2 является ближайшим гомологом TRAF6 млекопитающих, и это единственный белок TRAF дрозофилы, который содержит домен RING, типичный для лигаз E3.Однако нокдаун РНКи и доминантно-отрицательные исследования показывают, что dTRAF2 не участвует ни в IMD, ни в Toll сигнальных путях в клетках S2. Фактически, этот ген экспрессируется в клетках S2 на неопределяемом низком уровне. В одном из предыдущих исследований сообщалось, что dTRAF2 физически и функционально взаимодействует с Pelle, ключевым сигнальным компонентом в сигнальном пути Toll, который контролирует противогрибковый иммунный ответ. Однако эти исследования были основаны на экспериментах по сверхэкспрессии и анализах связывания in vitro и , которые могли не отражать физиологическую роль dTRAF2.Напротив, недавняя публикация продемонстрировала, что мутанты dTRAF2 не могут полностью индуцировать гены антимикробных пептидов после заражения E. coli . Однако эти исследования четко не определили, участвует ли dTRAF2 в путях Toll или IMD. Данные предполагают, что dTRAF2 не является критическим компонентом пути IMD в клетках S2. Дальнейшие исследования на клетках и на мухах необходимы для выяснения роли dTRAF2 в иммунитете дрозофилы (Zhou, 2005).

    Считается возможность, что другие RING-содержащие белки дрозофилы могут быть вовлечены в иммунитет дрозофилы.Однако исследования нокдауна РНКи с 10 различными генами, кодирующими домен RING, не смогли заблокировать ни Toll, ни IMD пути. Наконец, поскольку структура RING-домена Rad5 была успешно смоделирована для соответствия структуре димерного убиквитин-конъюгированного ферментного комплекса Ubc13 / UEV1a, было высказано предположение, что потенциальная убиквитинлигаза, участвующая в пути IMD, может физически взаимодействовать с Bendless и dUEV1a. Поэтому двухгибридный скрининг дрожжей был проведен с использованием Bendless и dUEV1a в качестве приманок для выявления их партнеров по взаимодействию с белками.Белок RING дрозофилы, CG14435, был идентифицирован в таких скринингах. CG14435 надежно взаимодействует как с Bendless, так и с dUEV1a в дрожжевых двугибридных анализах. Кроме того, взаимодействие CG14435-Bendless и CG14435-dUEV1a было подтверждено совместной иммунопреципитацией сверхэкспрессированных белков в клетках S2. Однако исследования на основе РНКи предполагают, что CG14435 не участвует в сигнальных путях врожденного иммунитета дрозофилы. Было показано, что бесхарактерных мух обнаруживают дефектные синаптические связи и аномальную морфологию в зрительной системе, что свидетельствует о функциях безгибания в различных процессах развития.Кроме того, гомологов Saccharomyces cerevisiae и Bendless и dUEV1a участвовали в репарации повреждений ДНК. Следовательно, возможно, что CG14435 участвует в некоторых клеточных процессах, помимо иммунитета, которые требуют Bendless и dUEV1a. Необходимы дальнейшие исследования, чтобы выяснить физиологическую роль CG14435 и идентифицировать активность убиквитинлигазы, необходимую для зависимой от убиквитинирования активации DmIKK (Zhou, 2005).

    Как и в пути TRAF6, dTRAF2 и / или другие лигазы E3, которые функционируют с Bendless и dUEV1a в пути IMD, могут быть мишенью (ами) полиубиквитинирования K63.Другой возможной мишенью Bendless / dUEV1a-опосредованного убиквитинирования является субъединица IKKγ дрозофилы (также известная как NEMO у млекопитающих) комплекса IKK. У млекопитающих недавно было показано, что NEMO представляет собой полиубиквитинированный K63 комплекс Ubc13 / UEV1a в ответ на экспрессию Bcl10 или активацию Т-клеток. Другие возможные мишени убиквитинирования с помощью Bendless и dUEV1a в пути IMD включают гомолог TAB2 дрозофилы и IMD. Недавно было показано, что два гомолога TAB2 и TAB3 у млекопитающих были убиквитинированы или связаны с другими убиквитинированными белками.Кроме того, недавно было показано, что RIP1 млекопитающих, который гомологичен белку IMD, особенно по его домену гибели, полиубиквитинирован K63 и связан с TAB2 TNFalpha-зависимым образом. В любом случае полиубиквитиновые цепи K63, вероятно, функционируют для рекрутирования комплекса TAK1 / TAB2 дрозофилы через полиубиквитин-связывающий домен TAB2 K63 на один (или оба) вышестоящие активаторы, такие как IMD, и / или нижележащую мишень активности киназы dTAK1. , комплекс IKK дрозофилы (Zhou, 2005).

    Как и ожидалось, эпистатический анализ, представленный в этом исследовании, демонстрирует, что IMD функционирует выше всех других компонентов пути, кроме рецептора PGRP-LC, и требуется для активации IKK. Более того, Bendless и dUEV1a функционируют ниже IMD и выше dTAK1, как предсказано из модели для Ubc13 и UEV1a у млекопитающих. dTAK1 необходим для активации комплекса IKK дрозофилы и, вероятно, функционирует как киназа IKK (Zhou, 2005).

    Хотя установлено, что dFADD и DREDD необходимы для пути IMD, предыдущие эксперименты показали, что они действуют ниже комплекса DmIKK.Например, сверхэкспрессия DREDD у мух приводит к экспрессии гена диптерицина в отсутствие грамотрицательной бактериальной инфекции, а активация гена диптерицина , опосредованная DREDD, не требует ни комплекса DmIKK, ни dFADD. Кроме того, недавние исследования показали, что DREDD взаимодействует с Relish и что для активации Relish, индуцированной пептидогликаном, требуется сайт расщепления каспазой внутри Relish. Поэтому было высказано предположение, что DREDD функционирует ниже комплекса DmIKK путем прямого расщепления DmIKK-фосфорилированного Relish.Эта возможность согласуется с наблюдением, что DREDD и dFADD необходимы для dTAK1Delta-опосредованной активации гена Diptericin . Неожиданно, dFADD и DREDD необходимы для индуцированной пептидогликаном активации DmIKK, утверждая, что DREDD и dFADD действуют выше по ходу пути. Кроме того, DREDD также необходим для индуцированной пептидогликаном активации JNK, но ни DREDD, ни dFADD не требуются для dTAK1- или dTAK1Delta-опосредованной активации DmIKK, что позволяет предположить, что dFADD и DREDD действуют на шаге выше dTAK1 в ответ на пептидогликан.На основании этих наблюдений предполагается, что dFADD и DREDD играют двойную роль в пути передачи антибактериальных сигналов дрозофилы. С одной стороны, dFADD преобразует сигналы от IMD к DREDD, в результате чего активируется DREDD и обеспечивается расщепление Relish; Напротив, dFADD и DREDD вносят вклад в индуцированную пептидогликаном активацию DmIKK посредством механизма, который еще предстоит выяснить. DREDD может функционировать аналогично человеческой каспазе-8, которая представляет собой DED-содержащую апикальную каспазу, аналогичную DREDD. Недавно было показано, что каспаза-8 необходима для активации NF-kappaB в ответ на передачу сигналов TCR.Эта роль Caspase-8 требует ферментативной активности полноразмерного белка Caspase-8 и участвует в рекрутировании комплекса IKK в вышестоящий сигнальный комплекс CARMA1, Bcl10 и MALT1. Интересно, что MALT1 также является геном, подобным каспазе (иногда называемым паракаспазой), и считается, что он действует как вспомогательный фактор E3-лигазы с Ubc13 и UEV1a при TCR-опосредованной активации NF-kappaB. DREDD может аналогичным образом функционировать как дополнительные факторы E3-лигазы с Bendless и dUEV1a в качестве E2 в пути IMD (Zhou, 2005).

    Следующая схема предложена для антибактериального сигнального пути дрозофилы. Лечение пептидогликаном или грамотрицательная бактериальная инфекция приводит к активации мембраносвязанного белка распознавания пептидогликана, PGRP-LC. Активированный PGRP-LC, в свою очередь, преобразует сигнал в IMD. IMD, в свою очередь, взаимодействует с dFADD, а затем с DREDD. Предполагается, что IMD, dFADD и DREDD образуют комплекс, который способствует активации dTAK1, возможно, как часть лигазы E3. Этот комплекс, вероятно, будет функционировать вместе с Bendless / dUEV1a, чтобы активировать dTAK1, а затем DmIKK.После активации комплекс IKK дрозофилы фосфорилирует Relish, который впоследствии расщепляется. N-концевой продукт расщепления Relish, фактор транскрипции NF-kappaB, затем перемещается в ядро, где активирует экспрессию гена антимикробного пептида.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *