Бп из атх с регулировкой напряжения и тока: БЛОК ПИТАНИЯ С РЕГУЛИРОВКОЙ ТОКА И НАПРЯЖЕНИЯ

Содержание

БЛОК ПИТАНИЯ С РЕГУЛИРОВКОЙ ТОКА И НАПРЯЖЕНИЯ

   Попалась в интернете недавно любопытная схемка простого, но довольно неплохого блока питания начального уровня, способного выдавать 0-24 В при ток до 5 ампер. В блоке питания предусмотрена защита, то есть ограничение максимального тока при перегрузке. В приложенном архиве есть печатная плата и документ, где приведено описание настройки данного блока, и ссылка на сайт автора. Прежде чем собирать, прочитайте внимательно описание.

Схема БП с регулировкой тока и напряжения

   Изначально на фото печатной платы автора были ошибки, печатка была скопирована и доработана, ошибки устранены.

   Вот фото моего варианта БП, вид готовой платы, и можно посмотреть как примерно применить корпус от старого компьютерного ATX. Регулировка сделана 0-20 В 1,5 А. Конденсатор С4 под такой ток поставлен на 100 мкФ 35 В.

   При коротком замыкании максимум ограниченного тока выдается и загорается светодиод, вывел резистор ограничителя на переднюю панель.

Индикатор для блока питания

   Провёл у себя ревизию, нашёл пару простеньких стрелочных головок М68501 для этого БП. Просидел пол дня над созданием экрана для него, но таки нарисовал его и точно настроил под требуемые выходные напряжения.

   Сопротивление используемой головки индикатора и применённый резистор указаны в прилагаемом файле на индикаторе. Выкладываю переднюю панель блока, если кому понадобится для переделки корпус от блока питания АТХ, проще будет переставить надписи и что-то добавить, чем создавать с нуля. Если потребуются другие напряжения, шкалу можно просто подкалибровать, это уже проще будет. Вот готовый вид регулируемого источника питания:

   Плёнка — самоклейка типа «бамбук». Индикатор имеет подсветку зелёного цвета. Красный светодиод Attention указывает на включившуюся защиту от перегрузки.

Дополнения от BFG5000

   Максимальный ток ограничения можно сделать более 10 А. На кулер — кренка 12 вольт плюс температурный регулятор оборотов — с 40 градусов начинает увеличивать обороты. Ошибка схемы особо не влияет на работу, но судя по замерам при КЗ — появляется прирост проходящей мощности.

   Силовой транзистор установил 2n3055, все остальное тоже зарубежные аналоги, кроме BC548 — поставил КТ3102. Получился действительно неубиваемый БП. Для новичков-радиолюбителей самое-то.

   Выходной конденсатор поставлен на 100 мкФ, напряжение не скачет, регулировка плавная и без видимых задержек. Ставил из расчёта как указано автором: 100 мкф ёмкости на 1 А тока. Авторы: Igoran и BFG5000.

   Форум по БП

   Форум по обсуждению материала БЛОК ПИТАНИЯ С РЕГУЛИРОВКОЙ ТОКА И НАПРЯЖЕНИЯ




ПРИСТАВКИ К МУЛЬТИМЕТРУ

Сборник из 10 конструкций и схем приставок к цифровым мультиметрам, расширяющих функционал измерительных приборов.




Вопрос: Как самостоятельно сделать блок питания переменного напряжения из блока питания ATX? — Компьютеры и электроника

Купон на $ 50 для новых пользователей!
Кликайте https://www.pcbgogo.com/.
Высококачественные прототипы и сборка печатных плат от PCBGOGO.
_
Для видео были взяты материалы с сайта: http://www.ruselectronic.com/news/prostoj-blok-pitanija/.
_
Купить простой блок питания: http://ali.pub/o0qfv.
DIY Блок питания с трансформатором: http://ali.pub/4nlt3q.
Блок питания 5А: http://ali.pub/4nlt5v.
Блок питания 9А: http://ali.pub/4nlt7f.
Лабораторный блок питания: http://ali.pub/4nltax.
Всё, чтобы самому собрать блок питания:
1) Микросхема LM317T: http://ali.pub/4nlvks.
2) Резисторы 2 Вт: http://ali.pub/4nlvpg.
3) Переменный резистор: http://ali.pub/4nlvu4.
4) Электролитические конденсаторы: http://ali.pub/4nlvw9.
5) Диодный мост: http://ali.pub/4nlvxm.

6) Понижающий трансформатор: http://ali.pub/4nlw0c.
7) Амперметр Вольтметр: http://ali.pub/4nltmz.
8) Макетные платы, 20 шт.: http://ali.pub/2uz4dm.
Текстолит: http://ali.pub/2uz506.
9) Хороший паяльник: http://ali.pub/2uym3f.
Припой (от 0.6 мм до 2 мм): http://ali.pub/2uynri.
Жидкий флюс: http://ali.pub/2uypem.
Готовый набор паяльщика: http://ali.pub/2uz7sw.
Дешёвые радиодетали и электронные компоненты: http://ali.pub/1x6j0c.
Набор 9 Схем для начинающих электронщиков: http://ali.pub/23lu1s.
* * * * * *.

Наш Telegram канал https://t.me/radiolubitelTV.

_

В этом выпуске вы узнаете: как сделать простой блок питания своими руками; как сделать регулируемый блок питания, который регулирует напряжения от 1 до 35 вольт..

Группа в ВК: https://goo.gl/pE36V9.

Реклама на канале: https://goo.gl/r9jM6p.

Почта (для сотрудничества): [email protected]

_

Смотрите наши видео, в которых мы простым языком рассказываем о радиотехнике, электронике и радиоэлектронике, а также об ардуино и товарах из Китая для радиолюбителей!.

Наши уроки будут особенно полезны как для начинающих радиолюбителей и студентов радиотехнических ВУЗов, так и для опытных электронщиков, которые паяют каждый день!.

В видеороликах мы даём основы электроники: определения, описания, схемы и принцип работы различных элементов радиотехники..

На канале проводятся уроки по Ардуино / Arduino; разбираем программирование, подключение датчиков, модулей, дисплеев, двигателей; создаём различные проекты и устройства на ардуино.

Надежный лабораторный блок питания


У меня есть регулируемый блок питания. Регулируется только напряжение, соответственно регулировка тока отсутствует. Для некоторых целей его хватает. Решил собрать блок с регулировкой тока и напряжения. Лабораторный блок питания, далее ЛБП, очень нужная вещь.
Схема ЛБП очень простая, так как использовать буду модуль DC-DC преобразователя из Китая.

Характеристики


Основные характеристики модуля:
  • Входное напряжение 5 — 40 Вольт;
  • Выходное напряжение 1.2 — 35 Вольт;
  • Выходной ток (мах) 9 Ампер, желательно установить кулер.

Схема блока питания


Как уже говорил, схема простая. Сетевое напряжение поступает на трансформатор. Имеется сетевой выключатель и предохранитель. Напряжение понижается трансформатором. Верхняя честь схемы силовая. Переменное напряжение поступает на диодный мост и сглаживающий конденсатор. Далее поступает на DC-DC преобразователь. С преобразователя напряжение поступает на выходные клеммы. Минус схемы разрывается приборчиком. Для удобства, регулировочные резисторы вынесены с платы.
Нижняя предназначена для питания вольтамперметра. Трансформатор имеет отдельную обмотку. Как и с силовой обмоткой, переменное напряжение поступает на диодный мост и фильтрующий конденсатор. Далее установил линейный стабилизатор на 5 Вольт.

Компоненты


Со схемой разобрались. Теперь переходим к компонентам.
Корпусом ЛБП будет служить старый корпус от регулятора паяльника. Регулятор паяльника еще времен СССР. Очень добротный.

Передняя панель будет из композитного пластика. Состоит пластик из двух пластин алюминия и пластика между ним. С одной стороны, он белый, с второй черный. Черная сторона будет лицевой.

Понижающий трансформатор от старого оборудования, уже не помню какого. Его пришлось слегка доработать. Сделал отвод на 22 Вольта, полная обмотка на 27 Вольт. Если оставить, то после диодного моста напряжение более 30 Вольт. Это много для стабилизатора 7805, установленного на [leech=http://]DC-DC преобразователе[/leech]. Он питает операционный усилитель схемы. Хоть и заявлено 40 Вольт, при учете максимального для 7805 в 30 Вольт.

Понижающий преобразователь постоянного тока.

Вольтамперметр на 3 сегмента. Для более точного отображения выходных параметров, нужно применить на 4-е сегмента. У меня какой был, такой и применил.

Клеммы времен СССР. Крепкие и надежные.

Конденсатор на 4700 мкф*63 Вольта. Из расчета 1000 мкф на 1 Ампер. На модуле установлены еще 2*470 мкф.

Диодный мост можно взять и единый, но у меня остался от старого проекта. Собран на 4-х диодах Д242.

Изготовление


На дне корпуса размечаем, сверлим отверстия под: трансформатор, диодный мост, модуль. Все спаиваем соответственно схемы. С модуля выпаял два подстроечных резистора. Вместо них припаял провода. На токовый 3 провода, на напряжение два.

Питать Вольтамперметр буду через линейный стабилизатор на 5 Вольт. Диодный мост КЦ402 и конденсатор небольшой емкости.

На задней панели делаю разметку под сетевой разъем и предохранитель. Все аккуратно выпиливаю и устанавливаю.

На передней панели размечаю и вырезаю все отверстия. Тут будут: выходные клеммы, сетевой выключатель, резисторы тока и напряжения, Вольтамперметр.

Распаял все элементы устанавливаемые изнутри. Сетевой выключатель коммутирует оба сетевых провода. Первоначально хотел применить другой.

Устанавливаем все элементы передней панели. Плюсовая клемма отмечена красной краской. Ручки резисторов разного цвета. Красная по цвету отображения Вольт. Желтая по току. Пока что не подписывал где ток и напряжение. Позже буду менять резисторы на многооборотные, ручки возможно тоже поменяю.

Верхнюю крышку покрасил. Между передней панелью и крышкой была слишком большая щель, ее закрыл небольшим уголком. При проверке блок выдал 9 Ампер на коротком, при 28 Вольтах, что составило чуть больше 250 Ватт.

Такой вот Лабораторный Блок Питания получился. Им можно как питать разного рода устройства, также заряжать аккумуляторы. Первоначально хотел применить импульсный источник на 24 Вольта, но попался трансформатор нужных габаритов. Так же, стараюсь собирать устройство из того что есть. Всем спасибо за внимание!

Смотрите видео


Регулируемый блок питания с режимом стабилизации напряжения и тока на основе АТХ — Блоки питания и ЗУ — Схемы — Каталог статей

С.П. Гапоненко, г. Чернигов РА 3-4, 9/2009
В основе блока питания (БП) лежит БП для компьютера формата АТХ модели Codegen 200XA1 250W ch.CG-07A. Но его с одинаковым успехом можно повторить и на любом другом БП (переделав соответственно печатную плату). Необходимым условием является использование ШИМ контроллера TL494 или его аналога.

Подробное описание работы этого контроллера описано в [3]
Схема блока питания показана на рис.1. Более 90% деталей используется непосредственно с компьютерного БП АТХ. Желательно, чтобы исходный БП был в исправном состоянии. Это избавит от проблем при первом включении. В противном случае нужно тщательно проверять каждый элемент, который устанавливается при сборке. Это касается как активных (микросхемы, транзисторы, стабилитроны, диоды), так и пассивных (резисторы, конденсаторы) элементов.

Высоковольтная часть БП осталась без изменений. Описывать ее нет смысла. Все это неоднократно рассматривалось, например, [1] и [2].
Выходная часть состоит из диодов VD18, VD19, в качестве которых можно применить 30CPQ150 или аналогичные. Параллельно каждому из диодов подключены демпфирующие RC-цепочки, снижающие уровень паразитных колебаний, возникающих на фронтах импульсов. L1 изготовлен из дросселя групповой стабилизации. Вместо существующих наматывается одна обмотка, состоящая из 6 витков провода ПЭВ-2 3×1,2 мм. L2 — готовый 5-вольтовый дроссель от БП. Резистор R56 нужен для разряда конденсаторов при уменьшении напряжения без подключенной нагрузки. Конденсаторы желательно применить, которые рассчитаны для работы в импульсном режиме при частоте до 100 кГц.
Довольно сложно было реализовать индикацию перехода БП  в режим стабилизации тока.  После нескольких неудачных попыток было найдено простое решение: применить для этого дополнительную микросхему DD2 TL494.

 


При переходе БП в режим стабилизации тока загорается светодиод HL2.
На микросхеме DA2 LM358 собран измерительный усилитель выходного напряжения и тока. Коэффициент усиления их выбран так, что при изменении напряжения и тока на входе от 0 до максимума, на выходе напряжения менялись от 0 до 2,5 В. Дальше они подаются на входы усилителей ошибки, соответственно 1 и 16 DD1. А на инверсные входы подаются опорные напряжения. С помощью резисторов R43, R47 регулируем величину опорного напряжения, тем самым изменяем величину напряжения и тока на выходе БП. На компараторе DA1 собран узел аварийной защиты, при срабатывании которой происходит блокировка работы ШИМ и силовые транзисторы VD16, VD17 запираются. Выход из этого состояния осуществляется выключателем «PowerON» или отключением БП от сети. В качестве датчика перегрузки используется трансформатор тока, состоящий из 30 витков провода ПЭВ2-0,2, намотанного на кольце диаметром 10 мм. Обмотка равномерно распределяется по всему кольцу. Первичная обмотка — вывод от трансформатора Т2.1, продетый через кольцо. Кольцо, в зависимости от вида трансформатора Т2, располагается или непосредственно на нем, или находится рядом. Светодиод HL1 служит для индикации срабатывания аварийной защиты.
На терморезисторе TR2 собран блок управления вентилятором, который при повышении температуры увеличивает обороты вентилятора. Сам терморезистор расположен в непосредственной близости от L1.
БП имеет блочную конструкцию. Если он покажется кому-то очень сложным, то его можно упростить, несколько ухудшив удобство в работе. На стабильности выходного напряжения это никак не отразится.
При необходимости, некоторые блоки можно исключить. Например, если не нужен индикатор перехода в режим стабилизации тока, то DD2 вместе с R50, VT9, R52, HL2 можно исключить. При этом проводник, соединенный с 14 выводом DD2, соединить с 14 выводом DD1.
Если не нужен блок управления вентилятором, то TR2, СЗЗ, R13, VT2, R16, R15, VT4 можно исключить, а вентилятор запитать непосредственно от катода VD5.
Если не нужна кнопка включения БП, то элементы R22, R23, VT5, R28, VD15, С31 можно не устанавливать, а левый вывод резистора R34 соединить с общим проводом.
Если не нужен блок аварийной защиты, то элементы Т4, R3, R6, VD4, С4, R10, DA1, VD11, R12, R11, R14, R19, VT3, R18, HL1, R17 можно не устанавливать. Но при пробое одного из диодов VD18 или VD19 могут выйти из строя высоковольтные транзисторы VD16, VD17 и диодный мост VD6-VD9.
Блок питания способен выдавать напряжение от 0 до 20 вольт при токе до 20 ампер (мощность не должна превышать рекомендуемую для Codegen 200XA1, те при 20 вольтах максимальный ток составит 10 ампер). Для получения на выходе более высокого напряжения, следует перемотать вторичную обмотку силового трансформатора.

При включении блока питания, на индикаторе появится установленное напряжение. Но на выходе блока питания напряжение будет отсутствовать. Для того чтобы на выходе блока питания появилось установленное напряжение, нужно нажать кнопку S1. Срабатывает триггерная схема подачи питания. При этом загорается светодиод HL3, индицируя появление на выходе блока питания напряжения. Преимущество данной схемы подачи питания в том, что при включении блока питания, либо после перебоев в подаче электроэнергии, на выходе напряжение всегда будет отсутствовать. При первом нажатии кнопки S1 питание включается, а при втором нажатии кнопки S1

 

 

питание отключается. Применены два реле с одной группой переключающих контактов в каждом. Реле К2 с допустимым током коммутации не менее максимального тока нагрузки блока питания (20 Ампер). Возможно применить одно реле с двумя группами контактов на переключение. Иногда потребуется подобрать резистор R59 для надежного включения и выключения реле. Схема собрана на отдельной печатной плате. В силу своей простоты и различий в применяемых реле, печатная плата не приводится.
Для контроля напряжения и тока применяется любой измерительный прибор. В авторском варианте использован вольтметр и амперметр на основе ICL7107CPL (КР572ПВ2А) с семисегментными светодиодными индикаторами ВА56-11GWA. Подробное описание которых находится соответственно в [4] и [5]. Оба индикатора собраны на одной односторонней плате.
О деталях блока питания: все детали взяты с исходного блока питания, кроме дополнительной микросхемы DD2, самодельного дросселя L1, DA2 и его обвязки. В качестве R33 взято два резистора по 0,1 Ом мощностью 2 Вт, соединенные параллельно. Сборку 30CPQ150 можно заменить на другую аналогичную. Или поставить отечественные диоды КД21 ЗА или КД2999А, желательно по два параллельно в каждом плече. На радиатор они устанавливаются через слюдяную прокладку.
И, как обычно, если все детали исправны и ошибок в монтаже нет, то блок питания начинает работать сразу.

 


Необходимо лишь выставить при помощи R6 максимальный ток, при котором срабатывает аварийная защита. Но все-же, при первом включении используйте последовательно включенную лампочку 60Вт 220 вольт. Это избавит Вас от многих проблем. Помните, часть элементов находится под напряжением в 300 вольт! Соблюдайте меры электробезопасности при налаживании и эксплуатации блока питания!

 


Литература
1. Куличков А.В. Импульсные блоки питания для IBM PC. 2-е изд., стер. — М.: «ДМК Пресс», 2002
2.  Головков А. В., Любицкий В.  Б.  Блоки питания для системных модулей типа IBM PC-XT/AT. — М.: «Лад и Н»,1995 год.
3.  Справочник. Интегральные микросхемы. Микросхемы для импульсных источников питания   и   их   применение.   -М.:»Додэка» 1997г.
4.  http://www.intersil.com/da-ta/fn/f n3082.pdf
5.  http://www.datasheetarchi-ve.com/pdf/815242.pdf

 

Регулирование потенциалзависимых калиевых каналов в гладких мышцах сосудов при гипертонии и нарушениях обмена веществ

Микроциркуляция. Авторская рукопись; доступно в PMC 1 января 2019 г.

Опубликован в окончательной редакции как:

PMCID: PMC5760350

NIHMSID: NIHMS8

Madeline Nieves-Cintrón

1 Кафедра фармакологии Калифорнийского университета, Дэвис, Калифорния

Арсалан У. Сайед

1 Кафедра фармакологии Калифорнийского университета, Дэвис, Калифорния

Мэтью А.Нисториак

2 Центр диабета и ожирения, Медицинский факультет Университета Луисвилля, Луисвилл, штат Кентукки, 40202

Мануэль Ф. Наведо

1 Кафедра фармакологии Калифорнийского университета, Дэвис, Калифорния

1 Кафедра фармакологии Калифорнийского университета, Дэвис, Калифорния

2 Центр диабета и ожирения, Медицинский факультет Университета Луисвилля, Луисвилл, штат Кентукки, 40202

* Для корреспонденции: Мануэль Ф.Наведо, доктор философии, факультет фармакологии, Калифорнийский университет, Дэвис, One Shields Avenue, Дэвис, Калифорния
, [email protected], тел. 530-752-6880, факс. 530-752-7710Финальная отредактированная версия этой статьи издателем доступна на Microcirculation. См. Другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

Управляемые напряжением калиевые каналы (K V ) являются ключевыми регуляторами сократимости гладких мышц сосудов и тонуса сосудов и, таким образом, имеют большое влияние на микроциркуляцию.Каналы K V являются важными детерминантами мембранного потенциала гладких мышц сосудов ( E m ). Ряд субъединиц K V экспрессируется в плазматической мембране гладкомышечных клеток. Каждая субъединица придает особую кинетику и регуляторные свойства, которые позволяют точно контролировать E m для управления сосудистым тонусом. Модификации экспрессии субъединицы K V и / или активности каналов могут вносить вклад в изменения сократимости гладких мышц сосудов в ответ на различные стимулы и при различных патологических состояниях.В соответствии с этим, ряд исследований предполагает, что изменения в экспрессии и / или функции субъединицы K V являются основными механизмами, способствующими дисфункции малорезистентной артерии при таких патологиях, как гипертония и метаболические нарушения, включая диабет. Здесь мы рассматриваем наши текущие знания о влиянии этих патологий на экспрессию и функцию каналов K V в гладкомышечных клетках сосудов, а также их влияние на (микро) сосудистую функцию.

Введение

На микроциркуляцию большое влияние оказывают сосудистые гладкомышечные клетки, выстилающие артериальную стенку мелких резистентных артерий и артериол.Сократительное состояние гладкой мускулатуры сосудов определяет диаметр этих сосудов и помогает установить уровень сосудистого тонуса. Это способствует правильному регулированию кровяного давления и кровотока для удовлетворения метаболических потребностей окружающих тканей. Связь дисфункции микрососудов у людей с рядом патологических состояний, включая гипертонию и диабет, подчеркивает важность этого механизма (40, 47, 67).

Тонус сосудов в значительной степени определяется динамическим взаимодействием между различными ионными проводимостью в гладких мышцах сосудов, которые помогают контролировать их мембранный потенциал ( E m ) и уровень внутриклеточного кальция (Ca 2+ ) (75).Соответственно, активность калиевых (K + ) каналов, включая ряд потенциал-управляемых каналов K + (K V ), является основным регулятором гладкой мускулатуры сосудов E m (38) . Каналы K V посредством их регулирования E m оказывают большое влияние на внутриклеточный Ca 2+ , модулируя вероятность открытия каналов Ca 2+ L-типа (и, возможно, каналов T-типа. (25)). Это важно, поскольку приток Ca 2+ через канал L-типа Ca 2+ Ca V 1.2 (например, Ca 2+ искр) необходим для сокращения гладких мышц сосудов (3, 37, 52). Физиологическая активация каналов K V гиперполяризует и расслабляет гладкие мышцы сосудов за счет снижения активности потенциал-управляемых каналов Ca 2+ и, следовательно, притока Ca 2+ , тогда как их ингибирование способствует сокращению (56). Таким образом, каналы K V являются важными регуляторами сосудистого тонуса.

K V каналов представляют собой разнообразную группу мембранных белков с 12 отдельными семействами, идентифицированными на сегодняшний день (K V 1-K V 12) (24).Каждый канал K V включает α-субъединицу K V , которая формирует ионопроводящую пору, и вспомогательную β-субъединицу K V , которая модулирует активность α-субъединиц K V . Субъединица K V α состоит из шести трансмембранных спиралей (S1-S6) с трансмембранным доменом S4, содержащим датчик напряжения. Тетрамер α-субъединиц K V образует ионопроводящую пору за счет взаимодействий домена S6 и P-петли между доменами S5 и S6.Клетки гладких мышц сосудов экспрессируют множество каналов K V в различных сосудистых руслах, включая K V 1 (K V 1,1, K V 1,2, K V 1,3, K V 1,5, K V 1.6), K V 2 (K V 2.1), а также элементы субъединиц K V 7 (K V 7.1-5) и бесшумных K V (K V 9.3) () (2, 5, 15, 75, 81). Каналы K V могут существовать в виде гомо- или гетеротетрамеров с различными биофизическими и фармакологическими свойствами.В гладких мышцах сосудов, например, K V 1,2 и K V 1,5, а также K V 7,4 и K V 7,5 могут образовывать гетеромерные каналы с глубоким влиянием на возбудимость клеток (36, 75). Сходным образом, совместная сборка со вспомогательными β-субъединицами K V и молчащими субъединицами K V обеспечивает дополнительное функциональное разнообразие (36).

Таблица 1

Экспрессия субъединиц K V в кровеносных сосудах разных видов

сосудистое русло вид Субъединицы K V ссылки
cereb. мышь 1.2, 1,5, 1,6, 2,1 (15, 58)
кролик 1,5, 1,6 (14)
крыса 1,2, 1,5, 2,1, 7,4, 7,5, 9,3 ( 2, 4, 5, 80, 81)
брыжеечные артерии мышь 1,2, 1,5, 2,1, 6,3, 7,4 (48, 58, 78)
крыса 1,2, 1,5, 2.1 (18, 44, 76)
коронарные артерии мышь 1.2, 1,5, 2,1, 7,4, 7,5 (63, 78)
крыса 1,2, 1,5, 7,1, 7,4, 7,5 (30, 35)
человек 1,5 ( 59)

K V Каналы представляют собой ключевые субстраты, лежащие в основе возбудимости гладких мышц сосудов в ответ не только на деполяризацию, вызванную давлением (например, сосудистый тонус), но и на вазоактивные вещества. Например, было показано, что каналы K V участвуют в ответе на вазодилататоры, такие как аденозин и β-адренергические агонисты.Эти вазодилататоры способствуют выработке цАМФ, активации протеинкиназы A (PKA) и фосфорилированию каналов K V , чтобы положительно модулировать функцию K V , способствуя вазодилатации (1). Ингибиторы K V также притупляют вызванную оксидом азота (NO) дилатацию артерий, предполагая, что каналы K V , по крайней мере, частично опосредуют NO-зависимые вазорелаксирующие эффекты в некоторых сосудистых руслах (21, 68, 70). Напротив, молекулы, которые активируют протеинкиназу C (PKC), обычно связаны с ингибированием каналов K V и деполяризацией мембранного потенциала.Например, было показано, что мощный вазоактивный пептид ангиотензин II и повышение уровня внеклеточной глюкозы вызывают сужение сосудов, по крайней мере частично, путем ингибирования каналов K V через PKC-опосредованный путь (16, 65, 71). Следовательно, изменения в экспрессии одной или нескольких субъединиц K V или сигнальных путей, регулирующих функцию K V , могут влиять на возбудимость гладких мышц сосудов и (микрососудистую функцию) во время физиологических и патологических состояний.Ремоделирование каналов K V может представлять собой основной механизм дисфункции микрососудов, влияющий на тонус сосудов и кровоток, приводящий к повреждению органов. В подтверждение этого исследования с использованием моделей на животных показали, что модификации экспрессии и / или функции каналов K V могут вносить вклад в изменения сократимости гладких мышц сосудов во время различных патологических состояний, таких как гипертония и метаболические нарушения, включая диабет. Здесь мы рассматриваем наши текущие знания, касающиеся изменений в экспрессии и функции K V в гладкомышечных клетках сосудов, связанных с гипертонией и метаболическими нарушениями, и их последствиями для (микрососудистой) функции.Роль каналов K V в легочной артериальной гипертензии и в почечной сосудистой сети здесь не рассматривается, но обширные недавние обзоры на эту тему можно найти в других источниках (26, 46, 50, 66).

Сосудистые потенциалозависимые каналы K

V при гипертонии

При гипертонии функция микроциркуляции нарушена. Было высказано предположение, что усиление сосудистого тонуса и снижение вазодилататорного ответа, по крайней мере частично, способствуют нарушению перфузии тканей и повреждению органов-мишеней во время этого патологического состояния (40).Изменения в экспрессии и / или функции каналов K V могут способствовать этому результату. Сообщалось о снижении активности канала K V во время гипертонии в гладких мышцах сосудов брыжеечных артерий крыс (9, 19, 32, 79), грудной аорты крыс (17, 32), аортальных артерий мыши (48), почечных артерий крыс. (12, 45), пиальные артерии крыс (4, 74), брыжеечные артерии мышей (32, 48) и пиальные артерии мышей (4). Эти изменения не зависят от используемой животной модели. Однако в более раннем исследовании сообщалось об увеличении активности канала K V в гладких мышцах гипертонических сосудов (18).Разница между этим и остальными исследованиями была связана с методологическими различиями, связанными с внутриклеточными уровнями Ca 2+ , которые опосредуют ингибирование каналов K V . Это не было очевидным в последующей работе по изучению влияния внутриклеточного Ca 2+ на функцию канала K V в гладких мышцах гипертонических сосудов из того же артериального русла (9). Таким образом, для дальнейшего прояснения этой загадки все еще требуются дополнительные исследования.

Механизмы изменений активности канала K V в гладких мышцах гипертонических сосудов были связаны, по крайней мере частично, с измененной экспрессией мРНК и / или уровня белка одной или нескольких субъединиц K V , лежащих в основе ток К В в этих ячейках.Снижение уровня экспрессии мРНК и / или белка для K V 1,2, K V 1,5 или обеих субъединиц было обнаружено в различных сосудистых руслах на генетических моделях артериальной гипертензии на животных (8, 74, 79). В ряде других исследований сообщалось о подавлении экспрессии мРНК / белка субъединицы K V 2.1 без видимого изменения уровней K V 1.X в церебральных и брыжеечных артериях на модели гипертензии, индуцированной ангиотензином II, и на генетической модели мыши. гипертонии соответственно (4, 5, 48).Совсем недавно было высказано предположение, что подавление экспрессии K V 7.4 способствует увеличению сократимости гладких мышц сосудов у крыс со спонтанной гипертензией (12, 32, 35). Эти результаты предполагают ключевую роль нескольких субъединиц K V в регуляции токов K V , сокращении гладких мышц сосудов и реактивности сосудов во время гипертензии. Кроме того, они подчеркивают важность методологических условий, видов животных, моделей артериальной гипертензии и сосудистого русла на животных при разработке дизайна экспериментов и интерпретации результатов.

Подробная механистическая информация об изменениях экспрессии K V 2.1 в гладких мышцах сосудов из пиальной и брыжеечной артерий во время гипертонии, индуцированной ангиотензином II, включающей активацию кальциневрина, зависимого от Ca 2+ n uclear f Актор a активировал изоформу c3 (NFATc3) клеток T сигнальный путь () (4, 5). Соответственно, хроническая активация передачи сигналов ангиотензина II, опосредованная направленной PKC, стимулирует активность канала Ca 2+ L-типа, что приводит к усилению притока Ca 2+ и активности кальциневрина (51, 53).Опосредованное кальциневрином дефосфорилирование фактора транскрипции NFATc3 способствует его ядерной транслокации (57). Попадая в ядро, NFATc3 подавляет экспрессию мРНК K V 2.1 и уровни белка, что приводит к снижению зависимых от напряжения токов K + . Снижение функции K V 2.1 приводит к деполяризации мембраны, дальнейшей активации каналов Ca 2+ L-типа и притоку Ca 2+ (4, 57). Это может создать петлю положительной обратной связи, которая потенциально может увековечить патологический сигнал.Эта петля может быть прервана ингибированием каналов Ca 2+ L-типа, кальциневрина или NFATc3 (4). Напротив, молекулярные механизмы, лежащие в основе изменений экспрессии субъединиц K V 1.X и K V 7.X в гладких мышцах сосудов во время гипертонии, неясны и, безусловно, потребуют дальнейшего изучения. Более того, учитывая, что в большинстве исследований используются мужские ткани / клетки грызунов, будет важно расширить исследования на образцы, использующие женские ткани и, если возможно, сосудистую сеть человека.

Предлагаемый механизм подавления экспрессии и функции канала K V при гипертензии, индуцированной ангиотензином II

В физиологических условиях экспрессия и функция нескольких субъединиц K V , включая K V 1.X, K V 2.1 и K V 7.X противодействуют деполяризации, вызванной давлением, для ограничения активности LTCC и сокращения гладких мышц сосудов. Во время хронической активации передачи сигналов ангиотензина II, как при гипертонии, активация PKC стимулирует активность LTCC, тем самым увеличивая глобальный приток Ca 2+ и способствуя сокращению.Это увеличение притока Ca 2+ может также стимулировать активацию кальциневрина кальциневрина, нацеленного на фосфатазу Ca 2+ / кальмодулин-зависимого, нацеленного на AKAP150. Эта фосфатаза дефосфорилирует фактор транскрипции NFATc3, позволяя ему перемещаться в ядро. Попав в ядро, NFATc3 может регулировать экспрессию гена, включая подавление экспрессии субъединиц K V 2.1 (но не K V 1.2 и K V 1.5). Это снижает гиперполяризацию мембранного потенциала обратной связи, что приводит к увеличению активности LTCC и притока Ca 2+ , сокращению гладких мышц сосудов и повышению тонуса сосудов во время гипертензии, индуцированной ангиотензином II.Эта петля обратной связи может быть прервана блокаторами LTCC, ингибированием кальциневрина или NFATc3 или нарушением взаимодействия между AKAP150 и кальциневрином. Неясно, происходит ли прямое фосфорилирование LTCC с помощью PKC, а также изменения в экспрессии K V 7.X в ответ на гипертензию, индуцированную ангиотензином II (обозначено знаком ??). Иллюстрация взаимодействия между AKAP150 и LTCC не обязательно отражает нативное взаимодействие между этими белками. Для простоты рисунок был нарисован именно так.

Сосудистые потенциалозависимые каналы K

V при метаболических нарушениях

Как и в случае гипертонии, изменения функции микроциркуляции также проявляются при метаболических нарушениях. Опосредованные диетой изменения липидного состава плазматической мембраны могут влиять на клеточную функцию, влияя на активность ионных каналов, включая каналы K V (39, 69). Первоначальные исследования показали снижение функции канала K + в гладких мышцах воротной вены кролика во время диетической гиперхолестеринемии (20) и в аорте мыши на генетической модели атеросклероза у мышей (34).Впоследствии снижение функции сосудистых каналов K V было подтверждено в артериях и артериолах на животных моделях гиперхолестеринемии, ожирения и метаболического синдрома, вызванного диетой (7, 22, 28, 29, 33, 60, 77). Это снижение функции сосудистых каналов K V привело к нарушению коронарной вазодилатации и кровотока во время метаболического синдрома, вызванного диетой (7, 60), аберрантной аденозин-опосредованной дилатации коронарных артерий и артериол свиней в моделях гиперхолестеринемии на животных (22, 29). ), которая не корректируется с помощью упражнений (28, 77), и сниженной релаксации артерии полового члена, вызванной силденафилом и нитропруссидом натрия, в генетической модели метаболического синдрома (33).Интересно, что функция канала K V в гладких мышцах коронарных артерий варьируется в базовых условиях, в ответ на диету и вазоактивные молекулы, а также во время упражнений в зависимости от пола (27, 77).

По большей части механизмы, лежащие в основе аберрантной функции канала K V в гладкомышечных клетках во время вызванной диетой гиперхолестеринемии, ожирения и метаболического синдрома, неясны. Никаких изменений в экспрессии мРНК субъединиц K V в коронарных артериолах не наблюдалось на юкатанской модели гиперхолестеринемии свиней (28).Скорее, было высказано предположение, что изменения в сигнальном пути, с помощью которого аденилатциклаза регулирует активность канала K V , по-видимому, вносят вклад в нарушение опосредованной аденозином вазодилатации коронарных артериол в этой модели на животных (28). Напротив, снижение уровней белка K V 1,5 в коронарных артериях было связано со снижением функции канала K V , что привело к нарушению коронарного кровотока в модели метаболического синдрома у свиней в Осабо (7). Различия между этими двумя исследованиями могут быть объяснены различиями в степени метаболических нарушений в ответ на диету между моделями животных (55).Совсем недавно было высказано предположение, что измененная функция каналов K V 7, но не изменения уровней мРНК или экспрессии белка, вносят вклад в нарушение дилатации в различных артериальных руслах в нескольких моделях метаболического синдрома на животных (33, 60). Эти исследования поднимают важные вопросы о конкретных механизмах, лежащих в основе измененной активности каналов K V в гладких мышцах, которые способствуют нарушению вазодилатации во время метаболических нарушений, что может стать основой для будущих экспериментов.Следовательно, необходимо предпринять согласованные усилия для тщательной оценки эффектов изменений липидного состава гладкомышечных мембран сосудов, а также содержания холестерина, как потенциального механизма, влияющего на их текучесть и функцию ионных каналов, включая каналы K V .

Сосудистые потенциалзависимые каналы K

V при гипергликемии

Высокий уровень глюкозы в крови (например, гипергликемия) является основным нарушением обмена веществ, которое способствует сосудистым осложнениям при диабете.Изменения во внеклеточном содержании глюкозы могут иметь большое влияние на функцию канала K V и реактивность сосудов. Соответственно, исследования продемонстрировали отличительную регуляцию функции канала K V в гладкомышечных клетках сосудов из нескольких сосудистых лож в ответ на острое и хроническое повышение концентрации внеклеточной глюкозы (31, 41-43, 58, 65, 71, 72). Во время резкого увеличения внеклеточной глюкозы активность канала K V подавляется в гладкомышечных клетках сосудов из брыжеечных артерий малого диаметра и паренхиматозных артериол головного мозга (31, 65, 71).Это опосредованное глюкозой ингибирование каналов K V зависит от концентрации и привело к деполяризации гладких мышц сосудов E m (31, 65), что привело к усилению вазоконстрикции (31, 71) (также см.) И нарушению нервно-сосудистого сцепления. (71). Механизм, лежащий в основе снижения активности канала K V в ответ на резкое увеличение внеклеточной глюкозы, по-видимому, не зависел от изменений в экспрессии субъединицы K V , но был отнесен к PKC-зависимому пути (31, 65, 71 ).Совсем недавно исследование показало, что дифференциальное взаимодействие изоформ PKCβ и PKCα может способствовать ингибированию каналов K V зависимым от концентрации глюкозы образом (31). Однако неясно, является ли опосредованное глюкозой ингибирование функции канала K V прямым фосфорилированием субъединицы K V или активацией другого PKC-зависимого пути. Кроме того, в отличие от предполагаемого PKC-опосредованного ингибирования каналов K V в ответ на повышенный уровень глюкозы, мы недавно обнаружили, что активность PKA необходима для индуцированного глюкозой вазоконстрикции церебральных паренхиматозных артериол (2).Эти результаты согласуются с недавними исследованиями пиальных артерий (62) и предполагают неожиданную роль PKA в сужении сосудов этих малых резистентных артерий, что требует дальнейшего исследования.

PKA требуется для вазоконстрикции паренхиматозных артерий головного мозга в ответ на повышенный уровень глюкозы

A) репрезентативные записи диаметра и B) суммарное hg-индуцированное сужение в отсутствие или в присутствии ингибитора PKA rpcAMPs (10 мкМ). Для получения пассивного диаметра использовали раствор, содержащий 0 мМ внеклеточного Ca 2+ и блокатор LTCC нифедипин (1 мкМ).* P <0,05.

Снижение функции каналов K V в ответ на хроническое повышение внеклеточной глюкозы также было зарегистрировано для гладких мышц сосудов из мелких коронарных и церебральных артерий (41-43, 58, 72). Интересно, что были описаны множественные пути, объясняющие снижение активности канала K V в ответ на хроническую гипергликемию. Более ранние исследования коррелировали снижение токов K V в гладких мышцах сосудов малых коронарных артерий, инкубированных с повышенным уровнем глюкозы в течение 24 часов, с опосредованным глюкозой производством супероксида и пероксинитрита.Это было связано со специфическим нитрованием субъединицы K V 1.2 (без изменения экспрессии белка K V 1.2 или K V 1.5), нарушением функции канала K V и потерей опосредованного цАМФ дилатации мелкие коронарные артерии (41-43). Недавнее исследование с использованием первичных гладкомышечных клеток коронарных сосудов, инкубированных с повышенным уровнем глюкозы в течение 48 часов, связывало снижение функции канала K V с уменьшением K V 1,2 и K V 1.5 уровней мРНК и белка (72). Этот процесс опосредован конечными продуктами гликирования (AGE) и требует взаимодействия AGE с его поверхностным рецептором RAGE (72). Снижение экспрессии мРНК K V 2.1 наблюдалось в мозговых артериях мышей, инкубированных с повышенным уровнем глюкозы в течение 48 часов, благодаря механизму, который требует нацеливания на фосфатазу кальцинейрин с помощью каркасного белка A, связывающего киназу 150 (AKAP150) (58). . С другой стороны, влияние острого и хронического повышения внеклеточной глюкозы на функцию K V 7 плохо изучено и требует дополнительных исследований.Тем не менее, различия в механизмах между вышеупомянутыми исследованиями (даже в клетках / артериях из одного и того же сосудистого русла) могут быть связаны с экспериментальными условиями и использованием различных животных моделей. Кроме того, эти наблюдения также повышают вероятность того, что различные механизмы могут взаимодействовать друг с другом, чтобы нарушить функцию канала K V и реактивность сосудов во время хронического повышения внеклеточной глюкозы с серьезными последствиями для сосудистых осложнений при диабете.

Модель подавления экспрессии и функции канала K V при диабете

PKA-опосредованное фосфорилирование активации серина 1928 индуцирует потенцирование LTCC в ответ на гипергликемию и во время диабета (62).Это приводит к увеличению глобального притока и сокращения Ca 2+ . Увеличение притока Ca 2+ способствует активации кальциневрина, нацеленного на AKAP150, который дефосфорилирует NFATc3 и делает возможным его ядерную транслокацию, где фактор транскрипции может подавлять экспрессию K V 2.1 (но не K V 1.2 и K В 1.5) подузлы. Это снижение экспрессии и функции K V 2.1 снижает управляемые по напряжению токи K + и гиперполяризацию мембранного потенциала с отрицательной обратной связью, что приводит к деполяризации мембранного потенциала, дальнейшему притоку Ca 2+ через LTCC, сокращению гладких мышц сосудов и повышенный тонус сосудов.Происходят ли изменения в субъединицах K V 7.X во время диабета по сигнальному пути кальциневрина / NFATc3 и происходят ли аналогичные изменения в сосудистой сети человека, требует дальнейшего изучения. Иллюстрация взаимодействия между AKAP150 и LTCC не обязательно отражает нативное взаимодействие между этими белками. Для простоты рисунок был нарисован именно так.

Сосудистые потенциалозависимые каналы K

V при диабете

Функция гладкомышечных клеток сосудов в микроциркуляции во время диабета нарушена (47), и изменения в экспрессии и / или функции каналов K V могут способствовать этому. исход.Действительно, большая часть опубликованных данных предполагает снижение функции каналов K V в гладких мышцах из различных сосудистых русел и на нескольких моделях диабета (10, 11, 13, 58, 72). Не удивительно и аналогично хронической гипергликемии, были описаны множественные механизмы, объясняющие измененную активность каналов K V в гладких мышцах сосудов во время диабета. В модели диабета 1 типа на крысах (например, диабет, индуцированный стрептозотоцином), снижение функции канала K V в гладких мышцах сосудов малых коронарных артерий было связано с подавлением K V 1.2 и усиление нитрования K V 1,2 (но не K V 1,5) из-за повышенной продукции супероксида (10, 11). Было показано, что это способствует нарушению опосредованной цАМФ дилатации (10, 11, 13). Интересно, что лечение антиоксидантным соединением Эбселен уменьшало нитрование K V 1.2 и улучшало экспрессию K V 1.2, активность канала K V , а также опосредованную цАМФ коронарную дилатацию у крыс с диабетом 1 типа (11). . Эти результаты предполагают потенциальный положительный эффект Эбселена при лечении сосудистых осложнений при диабете.

Однако в модели диабета 2 типа на крысах с высоким содержанием жиров (HFD) аберрантная активность канала K V в гладких мышцах коронарных сосудов и нарушение дилатации малых коронарных артерий коррелировали со снижением уровня мРНК и белка K V 1,2 и K V 1.5 субъединицы (72). В этом исследовании измененная экспрессия субъединицы K V , функция канала K V и опосредованная форсколином дилатация коронарной артерии во время диабета были улучшены у диабетических крыс, получавших ингибитор AGE аминогуанидин (72).Интересно, что лечение аминогуанидином не улучшало артериальное давление у диабетических крыс по сравнению с недиабетическими крысами, что, возможно, предполагает особую роль AGE в регуляции каналов K V или любой другой мишени в различных сосудистых руслах. Никаких изменений в экспрессии субъединицы K V , функции канала K V и опосредованной форсколином дилатации коронарной артерии не наблюдалось в артериях / клетках недиабетических крыс, получавших аминогуанидин. Эти результаты предполагают, что чрезмерная продукция AGE может быть патологическим сигналом выше по течению, приводящим к нарушению функции канала K V и реактивности коронарной артерии во время диабета.

Изменения функции канала K V и нарушение реактивности сосудов были также описаны для церебральных и брыжеечных артерий в модели диабета 2 типа на мышах HFD (58). В этом исследовании избирательное подавление транскрипции и снижение уровня белка субъединицы K V 2.1 (но не K V 1.2 и K V 1.5) были связаны с нарушением токов K V и повышенным тонусом сосудов во время диабета. Этот результат важен как изменения в K V 2.1 экспрессия и функция могут оказывать заметное влияние на внутриклеточную регуляцию Ca 2+ и E m , как показали эксперименты с математическим моделированием (49, 61). Механизмы, лежащие в основе этого избирательного подавления экспрессии и функции K V 2.1, зависят от активности канала L-типа Ca 2+ и нацеливания на PKA и кальциневрин с помощью AKAP150 (54, 58, 62). Соответственно, PKA-опосредованное увеличение притока Ca 2+ через каналы Ca 2+ L-типа активирует субпопуляцию кальциневрина, нацеленного на AKAP150 (54, 62).Затем кальциневрин дефосфорилирует NFATc3 и способствует его ядерной транслокации (61). Попадая в ядро, NFATc3 может подавлять экспрессию мРНК K V 2.1, что приводит к снижению уровней белка K V 2.1 и нарушению функции каналов K V (58). Как и в случае гипертонии, блокирование каналов Ca 2+ L-типа, предотвращение взаимодействия между кальциневрином и AKAP150 или ингибирование NFATc3 может нарушить этот всеобъемлющий путь. Взятые вместе, все эти исследования функции K V , приводящей к сосудистым осложнениям во время диабета, выявили фундаментальные различия и дивергентные механизмы, которые варьируются между сосудами и моделями на животных.Таким образом, относительный вклад всех вышеупомянутых путей в измененную экспрессию и функцию канала K V во время диабета должен быть тщательно оценен и интегрирован.

Выводы

K V каналы представляют собой основные субстраты, лежащие в основе возбудимости гладких мышц сосудов в малых артериях сопротивления и артериолах. В физиологических условиях способность каналов K V реагировать на деполяризацию, вызванную давлением, а также на вазоактивные молекулы, такие как вазодилататоры и / или вазоконстрикторы, помогает поддерживать тонкий баланс между сужением и расслаблением небольших резистентных артерий и артериол. это необходимо для соответствующего миогенного ответа и перфузии тканей.Неудивительно, что изменения функции каналов K V были связаны с нарушением реактивности сосудов при различных заболеваниях, влияющих на сосудистую сеть. Функция канала K V нарушается при артериальной гипертензии и при некоторых метаболических нарушениях, включая диабет. Механизмы, лежащие в основе нарушения функции канала K V при различных патологических состояниях (например, гипертония или диабет), различны. Это, скорее всего, отражает активацию уникальных сигнальных путей, которые явно влияют на экспрессию и / или функцию K V в гладкомышечных клетках сосудов при конкретном заболевании.Интересно, что также сообщалось о различных механизмах, объясняющих изменения в экспрессии и / или функции K V в рамках одного и того же патологического состояния. Различия в этом случае могут быть связаны с различными экспериментальными условиями, использованием клеток из разных сосудистых русел и / или болезненным состоянием, при котором проводились эксперименты. Независимо от причины, эти наблюдения указывают на то, что один механизм не учитывает все ремоделирование функции K V во время патологического состояния, и предполагают, что несколько путей могут синергизировать, чтобы изменить активность канала K V с серьезными последствиями для гладкости сосудов. мембранный потенциал мышц и реактивность сосудов, особенно в микроциркуляции.Следовательно, необходимы дальнейшие исследования, чтобы полностью оценить механизмы, лежащие в основе изменения активности канала K V при болезненных состояниях.

Учитывая разнообразную популяцию гомо- и гетеромерных каналов K V в гладкой мускулатуре сосудов от небольших резистентных артерий, необходимы дополнительные подходы, чтобы выявить и интегрировать специфический вклад каждой субъединицы в регуляцию мембранного потенциала и тонуса сосудов в тканях. здоровье и болезнь. Вычислительные подходы, а также варианты метода последовательной диссекции с зажимом мембраны, которые широко использовались в области сердца (6, 23, 49), могут быть реализованы для количественной оценки относительного вклада каждой субъединицы K V , которая может нелинейно взаимодействуют, регулируя возбудимость гладких мышц сосудов и реактивность сосудов.Кроме того, в решении этой задачи может помочь разработка оптических сенсоров, которые могут выборочно сообщать об активности различных субъединиц K V в ответ на изменения мембранного потенциала в живых клетках (73). В будущих исследованиях также следует более подробно рассмотреть различия в функции K V между полами и сосудистым руслом. Также необходимо более глубокое понимание того, как воспаление и окислительный стресс, процессы, общие для многих болезненных состояний, влияют на активность канала K V в нативных клетках.Модуляция каналов K V в гладких мышцах сосудов за счет различий в составе липидных мембран и их регуляторных механизмов, которые могут возникать при определенных патологических состояниях, требует дальнейшего изучения. Недавнее исследование клеток HEK выявило сложное, но функционально релевантное взаимодействие между фосфатидилинозитол-4,5-бисфосфатом (PIP 2 ) и субъединицей βγ G-белка, контролирующим активность канала 7,4 K V (64). Будет ли это взаимодействие между PIP 2 , Gβγ и K V 7 или любым другим каналом K V также происходить в нативных гладких мышцах сосудов, чтобы играть роль во время патологических состояний, неясно и должно быть рассмотрено в будущих исследованиях.Наконец, следует всесторонне изучить экспрессию, функцию и регуляцию каналов K V в гладких мышцах сосудов человека из мелких резистентных артерий и артериол. Это может выявить новые механизмы, регулирующие функцию канала K V при здоровье и болезни. Недавнее исследование с использованием гладкой мускулатуры сосудов из коронарных артериол пациентов с ишемической болезнью сердца предположило ключевую роль K V 1.5 в сосудистой реактивности и показало, что изменение функции канала K V в этих клетках не было связано с изменениями в K В 1.5, но со сниженной поверхностной локализацией этой субъединицы (59). Таким образом, лучшее понимание механизмов, лежащих в основе изменений функции K V в малых резистентных артериях и артериолах человека, может привести к выявлению потенциальных новых терапевтических целей для «исправления» дисфункции K V и лечения (микрососудистых) осложнений во время патологические состояния.

Благодарности

Мы благодарим мисс Марию Пас Прада за чтение рукописи.Эта работа была поддержана грантами NIH R01-HL098200 и R01-HL121059 и грантом AHA 14GRNT18730054 (для MFN), грантом NIH T32HL086350 (для AUS и MAN), AHA 16SDG27260070 (для MAN) и наградой за инновационное развитие UC Davis Academic Federation MN-C).

Ссылки

1. Айелло Э.А., Уолш М.П., ​​Коул В.С.. Фосфорилирование протеинкиназой А усиливает выпрямительный ток замедленного действия K + в гладкомышечных клетках сосудов кролика. Am J Physiol. 1995; 268: H926–934. [PubMed] [Google Scholar] 2. Альбарвани С., Немец Л. Т., Мэдден Дж. А., Тобин А. А., Англия СК, Пратт П. Ф., Руш, штат Нью-Джерси.Управляемые напряжением каналы K + в малых мозговых артериях крыс: молекулярная идентичность функциональных каналов. J Physiol. 2003 [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Amberg GC, Navedo MF, Nieves-Cintrón M, Molkentin JD, Santana LF. Кальциевые блестки регулируют локальный и глобальный уровень кальция в гладких мышцах артерий мыши. J Physiol. 2007; 579: 187–201. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Амберг GC, Rossow CF, Navedo MF, Santana LF. NFATc3 регулирует экспрессию Kv2.1 в гладких мышцах артерий.J Biol Chem. 2004. 279: 47326–47334. [PubMed] [Google Scholar] 5. Амберг ГК, Сантана Л.Ф. Каналы Kv2 препятствуют миогенному сужению церебральных артерий крыс. Am J Physiol Cell Physiol. 2006; 291: C348–356. [PubMed] [Google Scholar] 6. Banyasz T, Horvath B, Jian Z, Izu LT, Chen-Izu Y. Последовательное рассечение множественных ионных токов в одиночных сердечных миоцитах под действием фиксации потенциала. J Mol Cell Cardiol. 2011; 50: 578–581. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Бервик З.С., Дик Г.М., Моберли С.П., Кор М.С., Стурек М., Тьюн Дж.Д.Вклад потенциал-зависимых K (+) каналов в метаболический контроль коронарного кровотока. J Mol Cell Cardiol. 2012; 52: 912–919. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Братц И.Н., Дик Г.М., Партридж Л.Д., Канаги Н.Л. Снижение молекулярной экспрессии белков K (+) канала в гладких мышцах сосудов у крыс, у которых гипертензия была достигнута с помощью N {омега} -нитро-L-аргинина. Am J Physiol Heart Circ Physiol. 2005; 289: h2277–1283. [PubMed] [Google Scholar] 9. Братц И. Н., Сваффорд А. Н., младший, Канаги Н. Л., Дик Г. М.. Снижение функциональной экспрессии K (+) каналов в гладкомышечных клетках сосудов крыс, у которых гипертензия была вызвана N {омега} -нитро-L-аргинином.Am J Physiol Heart Circ Physiol. 2005; 289: h2284–1290. [PubMed] [Google Scholar] 10. Bubolz AH, Li H, Wu Q, Liu Y. Усиленный окислительный стресс ухудшает cAMP-опосредованную дилатацию за счет снижения функции Kv-канала в небольших коронарных артериях диабетических крыс. Am J Physiol Heart Circ Physiol. 2005; 289: h2873–1880. [PubMed] [Google Scholar] 11. Bubolz AH, Wu Q, Larsen BT, Gutterman DD, Liu Y. Ebselen снижает нитрование и восстанавливает функцию потенциалзависимого калиевого канала в малых коронарных артериях крыс с диабетом.Am J Physiol Heart Circ Physiol. 2007; 293: h3231–2237. [PubMed] [Google Scholar] 12. Чадха П.С., Зунке Ф., Чжу Х.Л., Дэвис А.Дж., Джеппс Т.А., Олесен С.П., Коул В.К., Моффатт Д.Д., Гринвуд И.А. Сниженная активность потенциал-зависимых калиевых каналов, кодируемых KCNQ4, лежит в основе нарушения опосредованного бета-адренорецепторами расслабления почечных артерий при гипертонии. Гипертония. 2012; 59: 877–884. [PubMed] [Google Scholar] 13. Чай Q, Лю З., Чен Л. Эффекты диабета, индуцированного стрептозотоцином, на Kv-каналы в малых коронарных гладкомышечных клетках крыс.Китайский физиологический журнал. 2005. 48: 57–63. [PubMed] [Google Scholar] 14. Cheong A, Dedman AM, Beech DJ. Экспрессия и функция субъединиц [K (V) alpha1] нативного калиевого канала в терминальных артериолах кролика. J Physiol. 2001; 534: 691–700. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Cheong A, Dedman AM, Xu SZ, Beech DJ. Каналы K (V) alpha1 в мышиных артериолах: дифференциальная клеточная экспрессия и регуляция диаметра. Am J Physiol Heart Circ Physiol. 2001; 281: h2057–1065. [PubMed] [Google Scholar] 16.Клемент-Чомьенн О., Уолш М.П., ​​Коул В.С.. Активация протеинкиназы C ангиотензином II снижает ток замедленного выпрямителя K + в сосудистых миоцитах кролика. J Physiol. 1996; 495 (Pt 3): 689–700. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Cox RH. Сравнение свойств каналов K + в свежевыделенных миоцитах грудной аорты WKY и SHR. Am J Hypertens. 1996; 9: 884–894. [PubMed] [Google Scholar] 18. Cox RH, Folander K, Swanson R. Дифференциальная экспрессия потенциал-управляемых генов канала K + в артериях от спонтанно гипертонических крыс и крыс Wistar-Kyoto.Гипертония. 2001; 37: 1315–1322. [PubMed] [Google Scholar] 19. Cox RH, Lozinskaya I, Dietz NJ. Отличия компонентов тока K + в миоцитах брыжеечной артерии от WKY и SHR. Am J Hypertens. 2001; 14: 897–907. [PubMed] [Google Scholar] 20. Кокс Р.Х., Туленко Т.Н. Нарушение функции сократительных и ионных каналов воротной вены кролика при диетическом атеросклерозе. Am J Physiol. 1995; 268: h3522–2530. [PubMed] [Google Scholar] 21. Фавалоро Ю.Л., Кемп-Харпер Б.К. Редокс-варианты NO (NO {средняя точка} и HNO) вызывают вазорелаксацию резистентных артерий посредством различных механизмов.Am J Physiol Heart Circ Physiol. 2009; 296: h2274–1280. [PubMed] [Google Scholar] 22. Franke R, Yang Y, Rubin LJ, Magliola L, Jones AW. Диета с высоким содержанием жиров изменяет K + -ток в коронарных артериях свиней и чувствительность к аденозину во время метаболического торможения. Журнал сердечно-сосудистой фармакологии. 2004. 43: 495–503. [PubMed] [Google Scholar] 23. Гранди Э., Сангинетти М.С., Бартос Д.К., Берс Д.М., Чен-Идзу Й., Чиамвимонват Н., Колкрафт Х.М., Делисл Б.П., Хейман Дж., Наведо М.Ф., Носков С., Проенца С., Ванденберг Д.И., Яров-Яровой В.Калиевые каналы в сердце: структура, функции и регуляция. J Physiol. 2017; 595: 2209–2228. [Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Gutman GA, Chandy KG, Grissmer S, Lazdunski M, McKinnon D, Pardo LA, Robertson GA, Rudy B, Sanguinetti MC, Stuhmer W, Wang X. Международный союз фармакологии. LIII. Номенклатура и молекулярные отношения потенциалзависимых калиевых каналов. Фармакологические обзоры. 2005; 57: 473–508. [PubMed] [Google Scholar] 25. Harraz OF, Welsh DG. Са (2) (+) каналы Т-типа в мозговых артериях: подходы, гипотезы и предположения.Микроциркуляция. 2013; 20: 299–306. [PubMed] [Google Scholar] 26. Хаябучи Ю. Действие калиевых каналов гладких мышечных клеток при патологии легочной артериальной гипертензии. Детская кардиология. 2017; 38: 1–14. [PubMed] [Google Scholar] 27. Куча CL, Bowles DK. Гендерно-специфический вклад K (+) — канала в индуцированную аденозином релаксацию коронарных артериол. Журнал прикладной физиологии. 2002. 92: 550–558. [PubMed] [Google Scholar] 28. Heaps CL, Jeffery EC, Laine GA, Price EM, Bowles DK. Влияние тренировок и гиперхолестеринемии на активацию аденозином потенциал-зависимых K + каналов в коронарных артериолах.Журнал прикладной физиологии. 2008; 105: 1761–1771. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Куча CL, Tharp DL, Bowles DK. Гиперхолестеринемия устраняет влияние потенциал-зависимого K + канала на аденозин-опосредованную релаксацию коронарных артериол свиней. Am J Physiol Heart Circ Physiol. 2005; 288: H568–576. [PubMed] [Google Scholar] 30. Hu Z, Ma A, Zhang Y, Xi Y, Fan L, Wang T, Zhang T. Экспрессия управляемых напряжением калиевых каналов в гладкомышечных клетках коронарных артерий SHR и WKY. Cell Biochem Biophys.2014; 70: 1725–1731. [PubMed] [Google Scholar] 31. Джексон Р., Бреннан С., Филдинг П., Симс М.В., Челлисс Р.А., Адлам Д., Сквайр И.Б., Радуга Р.Д. Отчетливая и взаимодополняющая роль альфа- и бета-изоферментов PKC в опосредовании сосудосуживающих реакций на резко повышенный уровень глюкозы. Br J Pharmacol. 2016; 173: 870–887. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Джеппс Т.А., Чада П.С., Дэвис А.Дж., Хархун М.И., Кокерилл Г.В., Олесен С.П., Хансен Р.С., Гринвуд И.А. Подавление активности канала Kv7.4 при первичной и вторичной гипертензии.Тираж. 2011; 124: 602–611. [PubMed] [Google Scholar] 33. Джеппс Т.А., Олесен С.П., Гринвуд И.А., Далсгаард Т. Молекулярная и функциональная характеристика каналов Kv 7 в артериях полового члена и кавернозном теле здоровых крыс и крыс с метаболическим синдромом. Br J Pharmacol. 2016; 173: 1478–1490. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Jiang J, Thoren P, Caligiuri G, Hansson GK, Pernow J. Повышенная фенилэфрин-индуцированная ритмическая активность в атеросклеротической аорте мышей за счет увеличения открытия KCa-каналов: связь с Kv-каналами и оксидом азота.Br J Pharmacol. 1999. 128: 637–646. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35. Ханамири С., Солтысинская Е., Джеппс Т.А., Бенцен Б.Х., Чадха П.С., Шмитт Н., Гринвуд И.А., Олесен С.П. Вклад каналов Kv7 в базальный коронарный кровоток и активный ответ на ишемию. Гипертония. 2013; 62: 1090–1097. [PubMed] [Google Scholar] 36. Килфойл П.Дж., Типпараджу С.М., Барски О.А., Бхатнагар А. Регулирование ионных каналов с помощью пиридиновых нуклеотидов. Circ Res. 2013; 112: 721–741. [Бесплатная статья PMC] [PubMed] [Google Scholar] 37.Узел HJ, Нельсон MT. Регулирование диаметра и стенки артерии [Ca 2+ ] в церебральных артериях крыс с помощью мембранного потенциала и внутрисосудистого давления. J Physiol. 1998; 508: 199–209. [Бесплатная статья PMC] [PubMed] [Google Scholar] 38. Узел HJ, Нельсон MT. Регулирование мембранного потенциала и диаметра с помощью зависимых от напряжения каналов K + в миогенных церебральных артериях кролика. Am J Physiol. 1995; 269: h448–355. [PubMed] [Google Scholar] 40. Леви Б.И., Амбросио Г., Прис А.Р., Струйкер-Будье HA.Микроциркуляция при гипертонии: новая цель лечения? Тираж. 2001; 104: 735–740. [PubMed] [Google Scholar] 41. Li H, Chai Q, Gutterman DD, Liu Y. Повышенный уровень глюкозы ухудшает cAMP-опосредованную дилатацию за счет снижения активности Kv-канала в малых коронарных гладкомышечных клетках крыс. Am J Physiol Heart Circ Physiol. 2003; 285: h2213–1219. [PubMed] [Google Scholar] 42. Ли Х., Гаттерман Д.Д., Руш Н.Дж., Бубольц А., Лю Ю. Нитрация и функциональная потеря потенциал-управляемых K + -каналов в коронарных микрососудах крыс, подвергшихся воздействию высокого уровня глюкозы.Сахарный диабет. 2004. 53: 2436–2442. [PubMed] [Google Scholar] 43. Лю Ю., Терата К., Руш, штат Нью-Джерси, Гаттерман Д.Д. Высокий уровень глюкозы ухудшает потенциал-зависимый ток канала K + в мелких коронарных артериях крысы. Circ Res. 2001; 89: 146–152. [PubMed] [Google Scholar] 44. Лу И, Ханна С.Т., Тан Г., Ван Р. Вклад субъединиц Kv1.2, Kv1.5 и Kv2.1 в нативный запаздывающий выпрямительный ток K + в гладкомышечных клетках брыжеечной артерии крысы. Естественные науки. 2002; 71: 1465–1473. [PubMed] [Google Scholar] 45.Мартенс-младший, Гельбанд СН. Изменения мембранного потенциала междолевой артерии крыс и K + каналов при генетической и негенетической гипертензии. Circ Res. 1996. 79: 295–301. [PubMed] [Google Scholar] 46. Montani D, Chaumais MC, Guignabert C, Gunther S, Girerd B, Jais X, Algalarrondo V, Price LC, Savale L, Sitbon O, Simonneau G, Humbert M. Целенаправленная терапия легочной артериальной гипертензии. Фармакология и терапия. 2014; 141: 172–191. [PubMed] [Google Scholar] 47. Монтеро Д., Вальтер Дж., Перес-Мартин А., Висенте-Салар Н., Рош Е., Винет А.Функция гладких мышц сосудов при сахарном диабете 2 типа: систематический обзор и метаанализ. Диабетология. 2013; 56: 2122–2133. [PubMed] [Google Scholar] 48. Морено-Домингес А., Сидад П., Мигель-Веладо Е., Лопес-Лопес-младший, Перес-Гарсия МТ. Экспрессия de novo Kv6.3 вносит вклад в изменения возбудимости гладкомышечных клеток сосудов у мышей с гипертонической болезнью. J Physiol. 2009. 587: 625–640. [Бесплатная статья PMC] [PubMed] [Google Scholar] 49. Моротти С., Ньевес-Синтрон М., Нисториак М.А., Наведо М.Ф., Гранди Э.Преобладающий вклад стимуляции канала Cav1.2 L-типа в нарушение внутриклеточного кальция и сужение сосудов головного мозга при диабетической гипергликемии. Каналы. 2017: 1–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 50. Муджил Р., Мишелакис Э.Д., Арчер С.Л. Роль k + каналов в определении тонуса легочных сосудов, чувствительности к кислороду, пролиферации клеток и апоптоза: влияние на гипоксическую вазоконстрикцию легких и легочную артериальную гипертензию. Микроциркуляция. 2006; 13: 615–632.[PubMed] [Google Scholar] 51. Наведо М.Ф., Амберг ГК. Локальная регуляция искр Са (2+) канала L-типа в гладких мышцах артерий. Микроциркуляция. 2013; 20: 290–298. [Бесплатная статья PMC] [PubMed] [Google Scholar] 52. Наведо М.Ф., Амберг Г.К., Вестенбрук Р.Э., Синнеггер-Браунс М.Дж., Каттералл В.А., Стриссниг Дж., Сантана Л.Ф. Каналы Cav1.3 продуцируют стойкие кальциевые искры, но каналы Cav1.2 ответственны за блестки в гладких мышцах артерий мышей. Am J Physiol Heart Circ Physiol. 2007; 293: h2359–1370.[PubMed] [Google Scholar] 53. Наведо М.Ф., Ньевес-Цинтрон М., Амберг Г.К., Юань К., Вотоу В.С., Ледерер В.Дж., Макнайт Г.С., Сантана Л.Ф. AKAP150 необходим для заикания стойких искр Ca2 + и гипертонии, индуцированной ангиотензином II. Circ Res. 2008; 102: e1 – e11. [PubMed] [Google Scholar] 54. Navedo MF, Takeda Y, Nieves-Cintron M, Molkentin JD, Santana LF. Повышенная активность искр Ca2 + во время острой гипергликемии и диабета в гладкомышечных клетках церебральных артерий. Американский журнал физиологии Клеточная физиология.2010; 298: C211–220. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Neeb ZP, Edwards JM, Alloosh M, Long X, Mokelke EA, Sturek M. Метаболический синдром и ишемическая болезнь сердца в Оссабау по сравнению с юкатанскими свиньями. Сравнительная медицина. 2010. 60: 300–315. [Бесплатная статья PMC] [PubMed] [Google Scholar] 56. Нельсон М. Т., Куэйл Дж. М.. Физиологические роли и свойства калиевых каналов в гладких мышцах артерий. Am J Physiol. 1995; 268: C799–822. [PubMed] [Google Scholar] 57. Ньевес-Цинтрон М., Амберг ГК, Наведо М.Ф., Молькентин Д.Д., Сантана Л.Ф.Контроль притока Ca2 + и передачи сигналов NFATc3 в гладких мышцах артерий во время гипертонии. Proc Natl Acad Sci U S. A. 2008; 105: 15623–15628. [Бесплатная статья PMC] [PubMed] [Google Scholar] 58. Ньевес-Цинтрон М., Нисториак М.А., Prada MP, Джонсон К., Файер В., Делл’Аква М.Л., Скотт Д.Д., Наведо М.Ф. Избирательное подавление функции Kv2.1 способствует повышению артериального тонуса при диабете. Журнал биологической химии. 2015; 290: 7918–7929. [Бесплатная статья PMC] [PubMed] [Google Scholar] 59. Нисидзима Ю., Цао С., Чабовски Д.С., Коришеттар А., Ге А., Чжэн Икс, Спарапани Р., Гаттерман Д.Д., Чжан Д.X.Вклад KV1.5 канала в индуцированное перекисью водорода расширение артериол у человека и его модуляция при ишемической болезни сердца. Circ Res. 2017; 120: 658–669. [Бесплатная статья PMC] [PubMed] [Google Scholar] 60. Ноблет Дж. Н., Оуэн М.К., Гудвилл АГ, Сассун Диджей, Тьюн Дж. Д. Сухая и ожирение периваскулярной жировой ткани коронарных артерий ухудшает вазодилатацию за счет дифференциального ингибирования K + -каналов гладких мышц сосудов. Артериосклероз, тромбоз и сосудистая биология. 2015; 35: 1393–1400. [Бесплатная статья PMC] [PubMed] [Google Scholar] 61.Нисториак М.А., Ньевес-Цинтрон М., Нигрен П.Дж., Хинке С.А., Николс С.Б., Чен С.Ю., Пуглиси Д.Л., Идзу Л.Т., Берс Д.М., Делл’аква М.Л., Скотт Д.Д., Сантана Л.Ф., Наведо М.Ф. AKAP150 способствует усилению сосудистого тонуса, способствуя ремоделированию K + -каналов с большой проводимостью, активированных Ca2 +, при гипергликемии и сахарном диабете. Circ Res. 2014; 114: 607–615. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Нисториак М.А., Ньевес-Цинтрон М., Патриарчи Т., Буонарати О.Р., Прада М.П., ​​Моротти С., Гранди Э., Дос Сантос Фернандес Дж., Форбуш К., Хофманн Ф., Сассе К.С., Скотт Д.Д., Уорд С.М., Хелл Дж.В., Наведо М.Ф.Фосфорилирование Ser1928 с помощью PKA стимулирует канал Ca2 + L-типа Cav1.2 и сужение сосудов во время острой гипергликемии и диабета. Сигнализация науки. 2017; 10 [Бесплатная статья PMC] [PubMed] [Google Scholar] 63. Nystoriak MA, Zhang D, Jagatheesan G, Bhatnagar A. Гетеромерные комплексы вспомогательных субъединиц KVbeta альдокеторедуктазы (AKR6A) регулируют сарколеммальную локализацию KV1.5 в миоцитах коронарных артерий. Химико-биологические взаимодействия. 2017 [Бесплатная статья PMC] [PubMed] [Google Scholar] 64. Повстян О.В., Баррезе В., Стотт Дж. Б., Гринвуд ИА.Синергетическое взаимодействие Gbetagamma и фосфатидилинозитол-4,5-бисфосфата определяет активность канала Kv7.4. Pflugers Arch. 2017; 469: 213–223. [Бесплатная статья PMC] [PubMed] [Google Scholar] 65. Радуга Р. Д., Харди М. Е., Станден Н. Б., Дэвис Н. В.. Глюкоза снижает ингибирование эндотелином потенциал-управляемых калиевых каналов в артериальных гладкомышечных клетках крыс. J Physiol. 2006; 575: 833–844. [Бесплатная статья PMC] [PubMed] [Google Scholar] 66. Salomonsson M, Brasen JC, Sorensen CM. Роль почечных сосудистых калиевых каналов в физиологии и патофизиологии.Acta Physiologica. 2017 [PubMed] [Google Scholar] 67. Serne EH, Stehouwer CD, тер Маатен JC, тер Wee PM, Rauwerda JA, Donker AJ, Gans RO. Функция микрососудов связана с чувствительностью к инсулину и кровяным давлением у здоровых людей. Тираж. 1999; 99: 896–902. [PubMed] [Google Scholar] 68. Соби CG, Фарачи FM. Ингибирующее действие 4-аминопиридина на ответы базилярной артерии на оксид азота. Br J Pharmacol. 1999; 126: 1437–1443. [Бесплатная статья PMC] [PubMed] [Google Scholar] 69. Спектор А.А., Йорек М.А.Липидный состав мембраны и клеточная функция. Журнал липидных исследований. 1985; 26: 1015–1035. [PubMed] [Google Scholar] 70. Стотт Дж. Б., Баррез В., Джеппс Т. А., Лейтон Е. В., Гринвуд И. А.. Вклад каналов Kv7 в вазодилатацию, опосредованную натрийуретическим пептидом, у нормальных и гипертензивных крыс. Гипертония. 2015; 65: 676–682. [PubMed] [Google Scholar] 71. Straub SV, Girouard H, Doetsch PE, Hannah RM, Wilkerson MK, Nelson MT. Регуляция тонуса внутримозговых артериол посредством K (v) каналов: эффекты глюкозы и PKC.Am J Physiol Cell Physiol. 2009; 297: C788–796. [Бесплатная статья PMC] [PubMed] [Google Scholar] 72. Су В, Ли В, Чен Х, Лю Х, Хуанг Х, Ли Х. Конечные продукты улучшенного гликозилирования ухудшают управляемую напряжением K + -каналы, опосредованную коронарной вазодилатацией у диабетических крыс. PLoS One. 2015; 10: e0142865. [Бесплатная статья PMC] [PubMed] [Google Scholar] 73. Тилли, округ Колумбия, Эум К.С., Флетчер-Тейлор С., Остин, округ Колумбия, Дюпре С., Патрон Л.А., Гарсия Р.Л., Лам К., Яров-Яровой В., Коэн Б.Е., Сак Дж. Т.. Хемоселективные токсины птицеедов сообщают об активации напряжения ионных каналов дикого типа в живых клетках.Proc Natl Acad Sci U S. A. 2014; 111: E4789–4796. [Бесплатная статья PMC] [PubMed] [Google Scholar] 74. Тобин А.А., Джозеф Б.К., Аль-Кинди Х.Н., Альбарвани С., Мэдден Д.А., Немец Л.Т., Руш, штат Нью-Джерси, Ри SW. Потеря цереброваскулярных K (+) каналов шейкерного типа: общий вазодилататорный дефект у крыс с генетической и почечной гипертензией. Am J Physiol Heart Circ Physiol. 2009; 297: h393–303. [Бесплатная статья PMC] [PubMed] [Google Scholar] 75. Тыкоцкий Н.Р., Боерман Э.М., Джексон В.Ф. Каналы гладких мышечных ионов и регуляция сосудистого тонуса в резистентных артериях и артериолах.Комплексная физиология. 2017; 7: 485–581. [Бесплатная статья PMC] [PubMed] [Google Scholar] 76. Xu C, Lu Y, Tang G, Wang R. Экспрессия потенциалзависимых генов K (+) каналов в гладкомышечных клетках брыжеечной артерии. Am J Physiol. 1999; 277: G1055–1063. [PubMed] [Google Scholar] 77. Ян Y, Джонс AW, Томас TR, Рубин LJ. Влияние секса, диеты с высоким содержанием жиров и физических упражнений на калиевые токи гладкой коронарной мышцы свиней. Am J Physiol Heart Circ Physiol. 2007; 293: h2553–1563. [PubMed] [Google Scholar] 78.Йунг С.Ю., Пуковски В., Моффатт Д.Д., Салдана Л., Шваке М., Охя С., Гринвуд И.А. Молекулярная экспрессия и фармакологическая идентификация роли каналов K (v) 7 в реактивности сосудов мышей. Br J Pharmacol. 2007; 151: 758–770. [Бесплатная статья PMC] [PubMed] [Google Scholar] 79. Чжан Ю., Гао Ю., Цзо Дж, Ли Р.М., Янссен Л.Дж. Изменение состава калиевых каналов гладких мышц артерий и модуляция тока BKCa при гипертонии. Европейский журнал фармакологии. 2005; 514: 111–119. [PubMed] [Google Scholar] 80.Чжун XZ, Абд-Эльрахман К.С., Ляо СН, Эль-Язби А.Ф., Уолш Э.Дж., Уолш М.П., ​​Коул В. Чувствительные к строматоксину гетеромультимерные каналы Kv2.1 / Kv9.3 вносят вклад в миогенный контроль диаметра церебральной артерии. J Physiol. 2010; 588: 4519–4537. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81. Чжун XZ, Хархун М.И., Олесен С.П., Охя С., Моффатт Д.Д., Коул В.С., Гринвуд И.А. Участие калиевых каналов KCNQ (Kv7) в миогенном контроле диаметра церебральной артерии. J Physiol. 2010; 588: 3277–3293. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Роли и регуляция потенциалзависимых кальциевых каналов при аритмиях

Abstract

Кальций, протекающий через потенциалзависимые кальциевые каналы в кардиомиоциты, опосредует связь возбуждения и сокращения, контролирует продолжительность потенциала действия и автоматизм в узловых клетках, и регулирует экспрессию генов.Правильное нацеливание на поверхность, а также базальная и гормональная регуляция кальциевых каналов жизненно важны для нормальной физиологии сердца. В этом обзоре мы обсуждаем роль потенциалзависимых кальциевых каналов в сердце и механизмы, с помощью которых эти каналы регулируются физиологическими сигнальными путями при здоровье и болезни.

Ключевые слова: Аритмии, кальций, кальциевые каналы, сердце

Введение

В сердце поступление кальция (Ca 2+ ) через потенциалзависимый канал Ca 2+ инициирует сцепление мышечного возбуждения и сокращения.Приток Ca 2+ также способствует фазе плато потенциала действия, активности кардиостимулятора в узловых клетках и модуляции критических клеточных процессов, включая метаболизм и экспрессию генов. Таким образом, приток Ca 2+ через потенциалзависимые каналы Ca 2+ в сердце связывает деполяризацию мембраны с клеточными функциями. В этом обзоре мы обсудим механизмы обработки Ca 2+ в сердце и то, как дисфункция потенциал-управляемых каналов Ca 2+ может приводить к аритмиям.Каналы Ca 2+ модулируются напряжением, Ca 2+ , посттрансляционными модификациями и межбелковыми взаимодействиями, которые также будут рассмотрены. Наконец, мы обсудим существующие фармакологические методы лечения, нацеленные на потенциал-управляемые каналы Ca 2+ .

Структура и электрофизиологическая функция клетки

Существует шесть классов потенциал-управляемых каналов Ca 2+ , которые можно классифицировать по активации мембранного напряжения (низкий или высокий), восприимчивости к фармакологическим антагонистам и скорости инактивации () ; к ним относятся каналы T-, L-, N-, P-, Q- и R-типа.Из них в кардиомиоцитах экспрессируются только продолжительные (L) — и временные (T) каналы Ca 2+ . 1,2 В номенклатуре каналов Ca 2+ за химическим символом кальция, Ca, следует нижний индекс «V», обозначающий напряжение в качестве первичного регулятора, и два числовых идентификатора, соответствующие субъединице α 1 подсемейство генов и порядок обнаружения внутри этого подсемейства, соответственно. 3,4 Ca V 1,1, Ca V 1.2, Ca V 1.3 и Ca V 1.4 демонстрируют относительно длительные токи и называются каналами Ca 2+ L-типа. Ca V 3.1, Ca V 3.2 и Ca V 3.3, которые являются каналами Ca 2+ T-типа, демонстрируют переходные токи Ca 2+ и активируются при более отрицательных потенциалах по сравнению с L- тип Ca 2+ каналов () .

Таблица 1:

Свойства управляемого напряжением Ca 2+ Каналы 64–68

CAC V

4 V 8

CACNA1H
Изоформа Тип Ген Локализация Антагонист 9019 Порог активации 9019 Ca V 1.1 L CACNA1S Скелетная мышца DHP, PLZ, BNZ ~ –20 мВ
Ca V 1,2 L 9000 9C Сердце, нервная система гладкая мышца, надпочечник, поджелудочная железа, почка, улитка DHP, PLZ, BNZ ~ –20 мВ
Ca V 1,3 L CACNA1D надпочечник, поджелудочная железа, легкое, яичко, улитка DHP, PLZ, BNZ ~ –40 мВ
Ca V 1.4 L CACNA1F Retina Неизвестно ~ –40 мВ
Ca V 2,1 P / Q CACNA201A улитка ω-агатоксин IVA
Ca V 2,2 N CACNA1B Нервная система поджелудочной железы ω-904 5 mVIA 9018 В 2.3 R CACNA1E Нервная система, сердце, улитка, поджелудочная железа, легкое SNX-482, Pb 2+ ~ –30 мВ
3,1 CACNA1G Сердце, нервная система, поджелудочная железа, гладкие мышцы, почки Мибефрадил, куртоксин, Ni 2+ ~ –60 мВ
Ca V 3,2 Сердце, нервная система, гладкие мышцы, почки Мибефрадил, куртоксин, Ni 2+ ~ –60 мВ
Ca V 3.3 T CACNA1I Нервная система Мибефрадил, куртоксин, Ni 2+ ~ –70 мВ

Каналы с закрытым напряжением 16 Ca 2+ из 900- образуя субъединицу α 1 и несколько вспомогательных субъединиц, включая β и α 2 δ () . Четыре гомологичных домена, каждый с шестью трансмембранными спиралями и петлей поры между S5 и S6, образующими субъединицу α 1 .Чередование положительно заряженных остатков аргинина или лизина в каждой третьей или четвертой позиции в S4 каждого домена придает чувствительность к напряжению. 5 Субъединица α 1 содержит сайты связывания для большинства регуляторов и лекарственных средств, тогда как субъединицы β, α 2 δ и γ вносят вклад в транспортировку, закрепление и регуляторные функции. Область пор содержит сайты связывания для всех основных агентов, блокирующих каналы Ca 2+ L-типа, включая дигидропиридины, фенилалкиламины и бензотиазепины () . 6

Схема топологии субъединицы α 1C , β и α 2 сердца. Субъединица β связывается с доменом α-взаимодействия в петле I – II субъединицы α 1C . CaM связывается с C-концом α 1C .

Существует четыре гена β-субъединиц (Ca V β 1–4 ). Субъединица β 2 является изоформой, преимущественно экспрессирующейся в сердце взрослого человека. Во всех различных β-субъединицах домены гуанилаткиназы (GK) и Src-гомологии 3 (Sh4) очень похожи, тогда как N-концы (вариабельная область 1), линкер между Sh4 и GK (вариабельная область 2), и С-концы (вариабельная область 3) совершенно разные. 7–9 Все субъединицы β взаимодействуют с порообразующей субъединицей α через внутриклеточную петлю между трансмембранными доменами I и II () . Клеточно-специфическим образом субъединицы β могут увеличивать транспортировку канала к плазматической мембране и модулировать как активацию, так и инактивацию. У мышей глобальная или кардиоспецифическая делеция гена Cacnb2 приводит к аномальному развитию сердца и гибели эмбриона. 10 Условная делеция субъединицы β 2 в кардиомиоцитах взрослых мышей вызывает снижение экспрессии белка β 2 примерно на 96%, но неожиданно только на 29% снижение тока Ca 2+ без очевидных сердечных сокращений. impairment, 11 , что означает, что во взрослом сердце экспрессия β 2 может быть расходуемой.Однако интерпретация этого результата неоднозначна, так как он осложняется остаточной (~ 4%) экспрессией β 2 , а также присутствием других β-изоформ Ca V , экспрессируемых во взрослых кардиомиоцитах. 9 Более того, противоположная точка зрения была представлена ​​исследованием, в котором короткая шпилька, опосредованная РНК, нокдаун β 2 в миоцитах взрослых крыс существенно уменьшала ток Ca 2+ . 12

Чтобы окончательно разрешить споры относительно роли субъединиц β в опосредовании трафика и регуляции каналов Ca 2+ в сердце, мы создали линии трансгенных мышей с тремя мутациями в домене α-взаимодействия в I –II петля субъединицы α 1C , которая делает порообразующую субъединицу α 1C неспособной связывать субъединицы β.С помощью этой новой модели мы окончательно продемонстрировали in vivo, что связывание β-субъединицы с α 1C не требуется для транспортировки и что базальная функция без β-Ca +2 каналов изменяется лишь минимально. 13

Субъединица α 2 δ представляет собой одиночный трансмембранный белок массой 175 кДа, кодируемый четырьмя генами ( Cacna2d1 , Cacna2d2 , Cacna2d3 и Cacna2d4 ) с несколькими вариантами сплайсинга. Хотя информационные РНК от α 2 δ 1 до 3 14 были идентифицированы в миокарде человека, известно, что только α 2 δ-1 связывается с Ca V 1.2 () .

Ca 2+ каналов инактивируются как по напряжению, так и по Ca 2+ -зависимым образом, но зависимая от Ca 2+ инактивация является доминирующим механизмом. Каналы Ca 2+ L-типа связаны с кальмодулином (CaM) () , который модулирует как зависимую от Ca 2+ инактивацию, так и зависимую от Ca 2+ облегчение, при этом токи Ca 2+ увеличиваются после повторяющаяся стимуляция. 15 Важность СаМ-регуляции каналов Са 2+ L-типа в сердце была продемонстрирована сверхэкспрессией в сердечных миоцитах взрослых мутантного белка СаМ, который не может связывать Са 2+ , что приводит к очень длительным потенциалам действия, поскольку потери Ca 2+ -зависимой инактивации. 16 Хотя вход Ca 2+ через канал Ca 2+ может вносить вклад в зависимую от Ca 2+ инактивацию, примечательно, что именно Ca 2+ высвобождается из саркоплазматического ретикулума через рецепторы рианодина. это основной фактор, определяющий инактивацию, зависящую от Ca 2+ .

Роль кальциевых каналов L- и T-типа в сердце

Понимание регуляции регуляции Ca 2+ миоцитов важно для понимания сердечного аритмогенеза.Ca V 1.2 расположен на поперечных канальцах в непосредственной близости с рианодиновыми рецепторами (RyR2), которые представляют собой внутриклеточные каналы высвобождения Ca 2+ , расположенные на саркоплазматическом ретикулуме. Вход Ca 2+ через каналы Ca 2+ L-типа запускает рианодиновые рецепторы для высвобождения Ca 2+ из саркоплазматического ретикулума в цитоплазму как часть процесса, известного как Ca 2+ -индуцированный Ca 2+ выпуск () . 17 Ca 2+ приток через Ca 2+ -канальный ток и высвобождение Ca 2+ через рианодиновые рецепторы необходимы для активации миофиламентов () .Ca 2+ связывается с тропонином C на тонкой нити, позволяя головкам миозина связываться с актином. 18 Сила сокращения пропорциональна концентрации Ca 2+ , окружающей миофиламенты. Чтобы полностью расслабить миоциты при подготовке к следующему сердцебиению, количество Ca 2+ , которое поступает в сердечную клетку во время устойчивого состояния, должно равняться количеству Ca 2+ , которое покидает клетку. 18 Снижение клеточной концентрации Ca 2+ происходит за счет транспорта Ca 2+ через саркоплазматический ретикулум Ca 2+ –аденозинтрифосфатный насос (SERCA) и сарколеммали Na + / Ca 2+ обменник () .Во время потенциала действия управляемые по напряжению каналы Ca 2+ открываются и позволяют Ca 2+ течь вниз по его электрохимическому градиенту, вызывая фазу плато (фаза 2) потенциала действия () . Вне t-канальцев каналы Ca 2+ L-типа также расположены в кавеолах — мембранных инвагинациях, важных для концентрации белков, которые необходимы для координации ответов на внеклеточные сигналы, при этом приток Ca 2+ может контролировать передачу сигнала. пути.В желудочковых миоцитах ток Ca 2+ почти полностью опосредуется каналом L-типа Ca 2+ , Ca V 1.2. В предсердных и особенно пейсмекерных клетках изоформа канала Ca 2+ L-типа Ca V 1.3, которая активируется при более отрицательных потенциалах, способствует деполяризации поздней фазы 4, которая лежит в основе автоматизма этих клеток () .

Связь возбуждения-сокращения в кардиомиоцитах. A и B: Ca 2+ , вход через Ca V 1.2 вызывает вызванное Ca 2+ высвобождение Ca 2+ через рецептор рианодина (RyR2). C: Ca 2+ связывается с тропонином C, вызывая образование перекрестных мостиков между актином и миозином. D: Ca 2+ закачивается обратно в саркоплазматический ретикулум через SERCA2a. Такое же количество Ca 2+ , которое поступает в ячейку через Ca V 1.2, откачивается из ячеек через Na + –Ca 2+ -обменник и насосы Ca 2+ (не показаны) . E : Ca 2+ связывается с CSQ в саркоплазматическом ретикулуме.

Диаграмма сердечного потенциала действия, показывающая фазы 0, 1, 2, 3 и 4. Во время фазы 0 приток Na + инициирует сердечный потенциал действия. Во время фазы 2 поступление Ca 2+ через канал Ca 2+ L-типа инициирует взаимодействие возбуждения-сжатия.

В отличие от тока Ca 2+ L-типа, ток Ca 2+ T-типа мало влияет на связь возбуждения и сокращения кардиомиоцитов в сердце. 19 Однако высокая плотность тока Ca 2+ Т-типа в узловых клетках 20 и эмбриональных кардиомиоцитах 21 согласуется с их предполагаемой ролью в функции водителя ритма. Каналы Ca 2+ T-типа вносят вклад в инициированную активность или активность кардиостимулятора, потому что они активируются при еще более отрицательных потенциалах, чем каналы Ca 2+ L-типа () . Однако они производят меньшие пиковые токи Ca 2+ и не могут заменить каналы Ca 2+ L-типа, потому что каналы Ca 2+ T-типа не нацелены на соединения сарколемма-саркоплазматический ретикулум и, следовательно, не могут инициировать саркоплазматический процесс. Ca 2+ выпуска.

Фармакология

Существует три основных химических класса лекарственных препаратов с органическими каналами Ca 2+ , а именно дигидропиридин (прототип: нифедипин), фенилалкиламины (прототип: верапамил) и бензотиазепины (прототип: дилтиазем). Все три класса лекарств связываются в пределах одной перекрывающейся области, близкой к поре и предполагаемым воротам активации. 22,23 Эти препараты мешают вольт-зависимой цикличности канала. 24–26 Незаряженные дигидропиридины, которые обладают более высоким сродством к конформации инактивированного канала (блокировка, зависящая от напряжения или использования), индуцируют и стабилизируют состояния инактивированных каналов. 24–27 Гладкомышечные каналы Ca V 1.2 более чувствительны к ингибированию дигидропиридинами, чем сердечные каналы Ca V 1.2, потому что состояния инактивированных каналов предпочтительны в артериальных гладкомышечных клетках из-за относительно деполяризованного мембранного потенциала этих клетки и вариант сплайсинга сегмента S6 домена 1, который специфически экспрессируется в этой ткани. 25,28,29

Ca V 1.3 менее чувствителен к дигидропиридинам, чем Ca V 1.2 есть. Фенилалкиламины и бензотиазепины связываются с открытыми и инактивированными состояниями с высоким сродством и стабилизируют состояния инактивированных каналов, замедляя восстановление после инактивации, что приводит к зависимому от использования ингибированию. 30,31 Следовательно, торможение увеличивается с увеличением частоты сердечных сокращений, что делает рациональным использование верапамила при тахиаритмиях. В то время как верапамил и дилтиазем всегда снижают входящие внутрь токи Ca 2+ , некоторые дигидропиридины, такие как (-) — BAY-K-8644 и (+) — SDS-202-791, являются модификаторами стробирования, которые действуют как агонисты, увеличивая амплитуды тока. , хвостовые токи и вероятность открытия одного канала. 27

Болезненные состояния / каналопатии

Увеличение продолжительности действия потенциала увеличивает нагрузку Ca 2+ внутри клеток из-за длительного поступления Ca 2+ и уменьшения диастолического интервала для Ca 2+ отток. Более того, некоторые каналы Ca 2+ L-типа снова становятся доступными в течение длительного периода действия потенциала действия, и каналы реактивируются, создавая входящий приток Ca 2+ , который может вызвать раннюю постдеполяризацию. 32 Повышенный ток Ca 2+ L-типа также способствует отсроченной постдеполяризации и вызванным Ca 2+ аритмиям, которые возникают после полной реполяризации и усугубляются перегрузкой саркоплазматического ретикулума Ca 2+ . Мутации в каналах Ca 2+ L-типа были связаны с синдромами наследственной аритмии.

Синдром Тимоти, мультисистемное заболевание, характеризующееся удлинением интервала QT и синдактилией, а также различными пенетрантными фенотипами расстройств аутистического спектра, черепно-лицевых аномалий и гипогликемии, 33 вызвано потерей инактивации, зависящей от напряжения. 33 Гетерогенный фенотип отражает распределение экспрессии в сердце, головном мозге, почках, желудочно-кишечном тракте, иммунной системе, гладких мышцах, семенниках, гипофизе и надпочечниках () . Диагноз обычно ставится в течение первых нескольких дней жизни из-за брадикардии плода, вызванной функциональной атриовентрикулярной блокадой 2: 1. Полностью выраженный синдром Тимоти обычно приводит к летальному исходу в первые годы жизни. Реполяризация заметно продлевается у большинства пациентов с синдромом Тимоти, при этом скорректированный интервал QT часто превышает 550-600 мс. 34 Врожденные пороки сердца присутствуют у 60% пациентов, а гипертрофия сердца и дилатация желудочков наблюдаются у 50% пациентов. 33–35 Желудочковые аритмии — наиболее частая причина смерти. На сегодняшний день нет опубликованных систематических исследований, оценивающих лучшую терапевтическую стратегию для пациентов с синдромом Тимоти. Имеющиеся данные подтверждают использование β-блокаторов и поздних блокаторов каналов Na + , а также использование имплантируемых кардиовертеров-дефибрилляторов для первичной профилактики. 36–39 Однако необходим тщательный мониторинг уровня глюкозы, поскольку β-адреноблокаторы могут маскировать гипогликемию, вызванную синдромом Тимоти.

Мутации в 19 генах были идентифицированы как связанные с фенотипом Brugada, вызывая либо уменьшение входящих токов Na + или Ca 2+ , либо увеличение исходящих токов K + . 40 Результирующий сдвиг наружу в балансе токов, активных во время фаз 1 и 2 эпикардиального потенциала действия, позволяет уже заметному переходному внешнему току K + увеличить реполяризацию фазы 1.Если мембранный потенциал слишком сильно реполяризован, каналы Ca 2+ L-типа не активируются, что приводит к снижению плато потенциала действия преимущественно в субэпикардиальных клетках правого желудочка, в которых кратковременный наружный ток K + является наибольшим. видный. Мутации потери функции в порообразующей субъединице α 1C , субъединице β 2b и субъединице α 2 δ 1 также были связаны с Brugada, ранней реполяризацией и синдромами короткого QT. . 41–44 Агенты, усиливающие токи L-типа Ca 2+ , такие как β-адренергические агонисты, обладают терапевтической эффективностью при синдроме Бругада. 40,45–47

Синдром короткого интервала QT 48 — одна из самых редких наследственных сердечных каннелопатий, характеризующихся ускоренной реполяризацией сердца. Это аутосомно-доминантное заболевание с пятью идентифицированными причинными генами, включая три, которые кодируют каналы K + ( KCNh3 , KCNQ1 и KCNJ2) и два, которые кодируют субъединицы L-типа Ca 2+ каналов ( CACNA1C и CACNB2 ). 49–51 Мутации в генах Ca V 1.2 CACNA1C и CACNB2b также были связаны как с идиопатической фибрилляцией желудочков, так и с синдромом ранней реполяризации. 43

Мутация в CACNA1D , которая кодирует Ca V 1.3, была идентифицирована в пакистанской семье с выраженной брадикардией в результате непроводящих каналов Ca V 1.3. 52 Потеря Ca V 1.3 снижает автоматизм в клетках кардиостимулятора.Взятые вместе, мутации основных субъединиц каналов Ca 2+ L-типа вызывают различные сердечные синдромы и аритмии, включая синдром удлиненного QT, синдром Тимоти, синдром Бругада, синдром короткого QT, раннюю реполяризацию и брадикардию.

Посттрансляционная регуляция кальциевых каналов

Адреналин и норадреналин связываются с β-адренорецепторами кардиомиоцитов, активация которых усиливает инотропию, лузитропию и хронотропию. 18 Активность как протеинкиназы A (PKA), так и Ca 2+ -CaM-активированной протеинкиназы (CaMKII) увеличивается при β-адренергической стимуляции, и обе киназы вызывают повышение Ca V 1.2 активность. Повышенная активация Ca V 1.2, в свою очередь, запускает повышенную сократительную способность и сигнальные пути, реагирующие на Ca 2+ , которые вносят вклад в патогенез сердечной недостаточности и гипертрофии. 53,54

Молекулярный механизм, ответственный за β-адренергическую регуляцию сердечного Ca V 1.2, остался загадкой. Эксперименты по экспрессии рекомбинантного Ca V 1.2 в культивируемых клетках (которые до недавнего времени были основным средством изучения Ca V 1.2) не дали однозначного ответа, поскольку регуляция β-адренорецепторов ненадежно восстанавливается в стандартных клеточных линиях, а кардиомиоциты безвозвратно изменяются при культивировании ex vivo. 55,56 Таким образом, необходимы исследования в родных системах. Неспособность идентифицировать какой-либо единственный сайт как важный для β-адренергической модуляции привела нас к предложению альтернативной гипотезы: что комбинация сайтов фосфорилирования в α 1C необходима для β-адренергической стимуляции Ca V 1.2. Поскольку β-адренергическая регуляция сердечного Ca V 1.2 является консервативной у позвоночных, мы идентифицировали консервативные консенсусные последовательности PKA в субъединице α 1C пяти видов: мыши, крысы, кролика, морской свинки и человека. Затем мы создали трансгенных мышей α 1C , у которых мы заменили 17 консервативных консенсусных сайтов фосфорилирования PKA, которые ранее не изучались, и пять консервативных сайтов фосфорилирования PKA / CaMKII, которые, как известно, были несущественными. 57–60 Неожиданно мы обнаружили, что ни один из этих консенсусных сайтов фосфорилирования PKA не был необходим. 61 Вместо этого мы обнаружили, что связывание субъединицы β с субъединицей Ca V 1.2 α 1C , но не фосфорилирование β PKA, абсолютно необходимо для увеличения тока Ca 2+ и сократительной способности сердца. ответ на стимуляцию ПКА, связанную с β-адренорецепторами. 13 Эти данные определяют ключевые регуляторные механизмы, влияющие на β-адренергическую регуляцию притока Са 2+ и сократительную способность сердца.

Ca V 1.2 также является основной мишенью CaMKII, и результирующее зависимое от Ca 2+ облегчение тока Ca V 1.2, наблюдаемое как положительная «лестница» тока Ca 2+ , в которой амплитуда тока увеличивается, а инактивация замедляется. на серию повторяющихся импульсов оказывает мощный прямой эффект на передачу сигналов Ca 2+ в сердце. Вероятно, что фосфорилирование субъединиц α 1C и β 2 необходимо для потенцирования CaMKII. 62,63

Удержание интрона в мРНК, кодирующей вспомогательную субъединицу натриевого канала насекомого, управляемого напряжением, модулирует экспрессию канала, регуляцию гейтинга и чувствительность к лекарствам

Abstract

Напряжение-управляемые натриевые каналы насекомых (Na v ) образованы хорошо известной порообразующей α-субъединицей, кодируемой para -подобным геном, и вспомогательными субъединицами, связанными с TipE в результате мутации, вызванной температурой. локус паралича E.«Роль этих вспомогательных субъединиц в модуляции биофизических и фармакологических свойств токов Na + недостаточно документирована. Уникальный нейрональный белок 1, гомологичный TipE-субъединице Drosophila melanogaster (DmTEh2), сильно усиливает экспрессию каналов Na v насекомых при гетерологичной экспрессии в ооцитах Xenopus . Здесь мы сообщаем о клонировании и функциональной экспрессии двух нейронов DmTEh2 -гомологов таракана, Periplaneta americana , PaTEh2A и PaTEh2B , кодируемых одним бицистронным геном.В PaTEh2B второй экзон, кодирующий последние 11 аминокислотных остатков PaTEh2A, смещен на 3’UTR за счет сохранения кодирующего сообщения, содержащего 96 п.о., содержащего интрон, таким образом генерируя новый C-конец. Мы исследовали гейтинг и фармакологические свойства варианта канала Drosophila Na v (DmNa v 1-1), коэкспрессируемого с DmTEh2, PaTEh2A, PaTEh2B или усеченным мутантом PaTEh2Δ (270-280) в Xenopus . ооциты. PaTEh2B вызывал снижение плотности тока в 2,2 раза, что сопровождалось эквивалентным уменьшением включения α-субъединицы в плазматическую мембрану, по сравнению с PaTEh2A и PaTEh2Δ (270–280).PaTEh2B положительно сдвигает зависимость активации и медленной инактивации каналов DmNa v 1-1 от напряжения в сторону более положительных потенциалов по сравнению с PaTEh2A, предполагая, что C-концевой конец обоих белков может влиять на функцию датчика напряжения и поры Na в канале . Интересно, что наши результаты показали, что чувствительность каналов DmNa v 1-1 к лидокаину и к метаболиту инсектицида пиразолинового типа DCJW зависит от связанных TEh2-подобных субъединиц.В заключение, наша работа впервые демонстрирует, что плотность, гейтинг и фармакологические свойства каналов Na v , экспрессируемых в ооцитах Xenopus , могут модулироваться процессом удержания интронов в транскрипции нейрональных TEh2-подобных вспомогательных субъединиц . P. americana .

Образец цитирования: Bourdin CM, Moignot B, Wang L, Murillo L, Juchaux M, Quinchard S, et al. (2013) Удержание интрона в мРНК, кодирующей вспомогательную субъединицу натриевого канала насекомых, управляемых напряжением, модулирует экспрессию канала, регуляцию гейтинга и чувствительность к лекарствам.PLoS ONE 8 (8): e67290. https://doi.org/10.1371/journal.pone.0067290

Редактор: Чжэ Чжан, Медицинский колледж Сюйчжоу, Китай

Поступила: 15 февраля 2013 г .; Одобрена: 16 мая 2013 г .; Опубликовано: 15 августа 2013 г.

Авторские права: © 2013 Bourdin et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была поддержана INRA и Région Pays de la Loire (стипендии для докторов наук Бенедикта Муаньо и Селин Бурден). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Напряжение управляемых натриевых каналов (Na v ) критически важно для инициирования потенциалов действия (AP) в возбудимых клетках [1].Из-за своей решающей роли в регуляции возбудимости мембран в нервной системе каналы Na v являются основными мишенями для многочисленных природных токсинов и терапевтических соединений, таких как местные анестетики (LA), противоэпилептические и антиаритмические средства [2]. Они также представляют собой главную молекулярную мишень для инсектицидов, таких как пиретроиды и инсектициды пиразолинового ряда (ПТИ), используемых для борьбы с вредителями [3], [4]. Они состоят из порообразующей субъединицы (α-субъединица), связанной с вспомогательными субъединицами.У насекомых два гена, родственные para , кодируют α-субъединицы каналов Na v [5], [6], разделяя высокую идентичность последовательностей с таковыми у позвоночных.

Вспомогательные субъединицы насекомых каналов Na v структурно не связаны с хорошо известными вспомогательными β-субъединицами каналов Na v позвоночных. В то время как вспомогательные β-субъединицы Na v млекопитающих являются одиночными трансмембранными белками [7], Drosophila melanogaster вспомогательных субъединиц (TipE и TEh2-4) содержат два трансмембранных сегмента [8], [9], [10] .В отличие от большинства α-субъединиц Na v млекопитающих, только экспрессия para (DmNa v 1) генерирует очень небольшие токи Na + в ооцитах Xenopus [8], [9], [10] . Первая описанная вспомогательная субъединица насекомых, TipE, сильно усиливает токи Na + при совместной экспрессии с DmNa v 1 в ооцитах Xenopus , что указывает на то, что эти белки обладают сильным шаперонным или стабилизирующим действием на экспрессию каналов [8], [8] [ 9], [10].Совсем недавно Дерст и соавт. [8], показывают, что TEh2 проявляет более сильный стимулирующий эффект экспрессии, чем TipE, на экспрессию DmNa v 1. Напротив, TEh3 и TEh4 в меньшей степени стимулируют экспрессию каналов, тогда как TEh5 не стимулирует вовсе. Совместная экспрессия DmNa v 1 и TipE приводит к токам Na + с такими же активационными свойствами, но с ускоренным затуханием тока, а также более высокой скоростью восстановления после инактивации [8], [10]. Более того, токи Na + , вызванные совместной экспрессией каналов DmNa v 1 и TipE или TEh2-4, проявляют специфические свойства инактивации и реприминга, напоминая функциональные свойства β-субъединиц млекопитающих [8], [10].

В D. melanogaster было обнаружено, что TEh2 экспрессируется исключительно в нейрональных тканях, тогда как TipE, TEh3-TEh5 имеют широкое тканевое распределение, включая невозбудимые клетки [8]. Это предполагает, что TEh2 и TEh2-подобные белки других видов насекомых являются важными элементами в модуляции возбудимости нейронов посредством модуляции воротных и фармакологических свойств каналов Na v . Действительно, TEh2 резко изменяет свойства инактивации (зависимость от напряжения и восстановление после инактивации) токов Na + , генерируемых каналами DmNa v 1 в ооцитах Xenopus по сравнению с TipE [8].Таким образом, мы предположили, что каналы DmNa v 1 / TEh2 обладают различными фармакологическими свойствами по сравнению с каналами DmNa v 1 / TipE.

PTI относятся к относительно новому классу инсектицидов, включая индоксакарб и метафлумизон, которые убивают широкий спектр насекомых, ингибируя каналы Na v [11]. Индоксакарб действует как проинсектицид, который биотрансформируется в токсичный N-декарбометоксилированный метаболит DCJW [12]. DCJW необратимо блокирует ПД в препаратах личиночного двигательного нерва чешуекрылых ( Manduca sexta ) и вызывает дозозависимое ингибирование каналов Na v в нейронах тараканов Periplaneta americana [13], [14].Ранее сообщалось о сходстве между блокирующим механизмом, индуцированным PTI и LA, такими как лидокаин [15]. Индоксакарб / DCJW и лидокаин предпочтительно связываются с инактивированными каналами, что приводит к стабилизации этого состояния [13], [14], [15], [16], [17], [18]. Поскольку эффективность PTIs зависит от инактивационных свойств каналов Na v [13], [14], [15], TEh2 также может дифференцированно модулировать чувствительность канала Na v к инсектицидам.

Модель таракана — это обычный инструмент для исследования того, модулируют ли нейротоксические инсектициды ионные каналы и каким образом. P. americana является подходящей нейробиологической моделью, для которой электрофизиологические и фармакологические исследования показали существование различных токов Na + с различными биофизическими и фармакологическими свойствами в изолированных нейронах [14], [19], [20]. Чтобы получить дополнительную информацию о молекулярных характеристиках каналов Na v в P. americana , мы клонировали и охарактеризовали два новых варианта teh2-подобного гена . Мы показали, что эти TEh2-подобные варианты экспрессируются исключительно в нервной системе P.americana и возник в результате исключения или удержания интрона, который модулирует экспрессию и стробирующие свойства варианта DmNa v 1-1, экспрессируемого в ооцитах Xenopus . Кроме того, мы исследовали биофизические свойства токов Na + , возникающих в результате совместной экспрессии DmNa v 1-1 с TEh2 и TEh2-подобными вариантами P. americana . Затем мы охарактеризовали фармакологические последствия совместной экспрессии этих вспомогательных субъединиц и наблюдали заметные различия в блокирующих эффектах лидокаина и DCJW на каналы DmNa v 1-1.

Материалы и методы

Насекомые

Взрослые самцы американских тараканов P. americana были получены из нашей лабораторной колонии, поддерживаемой при 29 ° C в течение 12-часового цикла свет / темнота с пищей и водой ad libitum . Кишечник, ганглии, половые железы, мышцы (извлеченные из тазобедренного сустава ног), голова и брюшной нервный тяж (грудные и брюшные ганглии вместе с соединительными элементами) иссекались от взрослых тараканов-самцов.

Экстракция РНК, ОТ-ПЦР и клонирование полноразмерных кДНК PaTEh2

Экстракция тотальной РНК была выделена из различных тканей с использованием реагента TRIzol® (Ozyme / Biogentex, Франция).Для экспериментов с полимеразной цепной реакцией (ПЦР) кДНК первой цепи были синтезированы из 5 мкг тотальной РНК с использованием SuperScriptTM III First-Strand Synthesis System Super Mix (Invitrogen, США) в присутствии олиго (dT) 20 . Последовательности праймеров, используемых в наших экспериментах, перечислены в таблице 1. Для клонирования кДНК PaTEh2 в нервном канатике была сконструирована пара вырожденных праймеров (DPS1 и DPR1) из консервативных областей, наблюдаемых при выравнивании доступных последовательностей субъединиц TEh2. ПЦР-амплификацию фрагмента кДНК проводили с использованием полимеразы EuroTaq (Eurobio, Франция).Продукты ПЦР разделяли электрофорезом в агарозном геле и очищали с использованием Nucleospin® Gel и PCR clean up (Macherey-Nagel, Германия). Фрагменты кДНК клонировали в PCR® 4 TOPO® (Invitrogen). Каждый клон был секвенирован в обеих цепях компанией Millegen Biotechnology. Для RACE (быстрой амплификации концов кДНК) 5′- и 3′-концов PaTEh2 использовали метод быстрой амплификации концов кДНК, опосредованной РНК-лигазой (набор GeneRacer ™, Invitrogen). Для амплификации 5′-концевой и 3′-концевой областей использовались специфичные для гена праймеры P-R1, P-R2, P-S1 и P-S2.Продукты ПЦР клонировали и секвенировали, как описано выше. Наконец, ORF кДНК PaTEh2 была амплифицирована с использованием ген-специфических праймеров P-S3 и P-R3, содержащих сайты рестрикционных ферментов Xma I и Xba I соответственно, для направленного клонирования в плазмиду pGEM-HEJUEL, подходящую для экспрессии. в ооцитах Xenopus (любезно предоставлено профессором Олафом Понгсом, Институт передачи нейронных сигналов, Гамбург, Германия). Анализ последовательностей выполняли с использованием программного обеспечения для анализа последовательностей BioEdit.Полноразмерные ORF были идентифицированы с помощью исследования BLAST в базе данных GenBank (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Выравнивание аминокислотных последовательностей проводили с использованием метода ClustalW, как описано [6].

Полуколичественные эксперименты с ОТ-ПЦР были выполнены для изучения картины распределения PaTEh2 в тканях с использованием пары праймеров P-S3 / R3. Эксперименты повторяли пять раз.

Экстракция геномной ДНК и ПЦР

Геномная ДНК была выделена из пяти особей тараканов с использованием процедуры, модифицированной Блина и Стаффорда [21].Ткани замораживали в жидком азоте и хранили при -80 ° C. Замороженные ткани гомогенизировали в буфере для экстракции (1 мл на 100 мг ткани), содержащем 10 мМ Трис-Cl (pH 8,0), 0,1 М EDTA (pH 8,0), панкреатическую РНКазу 20 мкг / мл, 0,5% SDS и инкубировали в течение 1 часа. при 37 ° С. Добавляли протеиназу К до конечной концентрации 100 мкг / мл и суспензию инкубировали при 50 ° C в течение 3 часов. Были проведены три экстракции фенолом, и ДНК в водной фазе осаждали 0,2 объема 10 М ацетата аммония и 2 объемами этанола.Геномную ДНК с высоким молекулярным весом выделяли с помощью пипетки Пастера. ДНК растворяли в ТЕ (pH 8,0) и хранили при 4 ° C. Pateh2 Ген амплифицировали с помощью вложенной ПЦР с использованием пары праймеров P-S4 / R4, а затем пары праймеров P-S3 / R3 с геномной ДНК в качестве матрицы. Амплифицированный продукт второй ПЦР клонировали и секвенировали, как описано выше.

Коэкспрессия вариантов DmTEh2 или PaTEh2 с DmNa

v 1.1 в ооцитах Xenopus laevis

Вариант сращивания натриевого канала от D.melanogaster , DmNa v 1.1, использовали для экспериментов по коэкспрессии [22]. Конструкция pGEM-DmTEh2 была любезно предоставлена ​​доктором Кристианом Дерстом (Институт интегративной нейроанатомии, Шарите, Берлин, Германия). Все рекомбинантные плазмиды были линеаризованы с помощью Spe I (Promega, Мэдисон, США) или Not I (Invitrogen), и кэпированная РНК была транскрибирована in vitro с использованием набора T7 mMESSAGE mMACHINE (Ambion, Остин, США).

долей яичников были получены хирургическим путем у взрослых особей Xenopus laevis , предварительно анестезированных трикаином (0.15 M, Sigma-Aldrich) и промывали стандартным физиологическим раствором ооцитов (SOS), состоящим из (в мМ): NaCl 100, KCl 2, CaCl 2 1,8, Hepes 5, pH 7,5. Дефолликулированные ооциты получали после 1 ч обработки 2 мг / мл коллагеназы (тип 1A, Sigma-Aldrich, Saint Quentin Fallavier, Франция) и 0,8 мг / мл ингибитора трипсина (Sigma-Aldrich) в SOS, не содержащем кальция. В зависимости от комбинации DmNa v 1-1 и вспомогательных субъединиц в ооциты вводили различные количества (от 2 до 35 нг) DmNa v 1-1 и смесь РНК вспомогательных субъединиц (соотношение 1: 1).Введенные ооциты инкубировали в стерильной среде, состоящей из SOS с добавлением гентамицина (50 мкг / мл), пенициллина (100 Ед / мл), стрептомицина (100 мкг / мл) и пирувата натрия (2,5 мМ) при 18 ° C в течение 2-10 дней. дней до записи.

Заявление об этике

Это исследование было проведено в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Европейского сообщества. Протокол был одобрен «Управлением ветеринарных служб штата Мэн и Луары» (N ° B49071) и «Комитетом по развитию плательщиков Луары» (N ° CEEA.2012.68).

Электрофизиологические записи и анализ

Токи

Na + регистрировали с помощью двухэлектродного фиксатора напряжения (TEVC). Ооциты тестировали с использованием электродов из боросиликатного стекла, наполненных 1 M-KCl / 2 M-кацетатом, подключенных к усилителю TEVC (TEV-200, Dagan Corporation, Миннеаполис, Минессота, США). Интерфейс Digidata 1440A (Axon CNS Molecular Devices, Калифорния, США) и программное обеспечение pCLAMP 10 (Axon CNS Molecular Devices) использовали для сбора данных (частота дискретизации: 10 или 100 кГц; полосовой фильтр: 5 кГц) и протоколов стимуляции.Все эксперименты проводятся при комнатной температуре (18–21 ° C) в SOS. Емкостные переходные процессы и токи утечки были скорректированы с использованием вычитания P / N (N = 6). Для экспериментов по активации семейства следов Na + генерировали ступенчатой ​​деполяризацией для проверки потенциалов от -70 до +40 мВ (с шагом 10 мВ) от удерживающего потенциала -100 мВ. Проводимость канала Na + (G) была рассчитана с использованием следующего уравнения: G = I / (V-V об. ), где I — амплитуда тока, V — испытательный потенциал, а V об. — обратный потенциал [23 ].Обратный потенциал был определен по кривой ВАХ, подобранной с использованием уравнения Штюмера: I = G * (1− (1 / (1 + exp ((V − V 1/2 ) / K)))) * (V− V rev ) [23]. Значения проводимости (G) были нормализованы к максимальной проводимости и нанесены на график в зависимости от испытательного напряжения. Полученные кривые были аппроксимированы следующим уравнением Больцмана G = 1 / (1 + exp ((V 1/2 −V) / k)), где V 1/2 — потенциал, при котором половина Na v каналов активированы, а k — коэффициент наклона [19].Чтобы определить зависимость напряжения от установившегося режима быстрой инактивации, семейства треков тока Na + были сгенерированы по двухимпульсному протоколу, начиная с шага потенциала в диапазоне от -80 мВ до +40 мВ (с шагом 5 мВ) в течение 200 мс. . Второй испытательный импульс длительностью 12 мс подавали на -5 мВ, потенциал, при котором амплитуда тока была максимальной. Каждую серию двойных импульсов разделяло 10 с. Для определения зависимости напряжения стационарной медленной инактивации использовался двухимпульсный протокол, начиная с первого шага потенциала в диапазоне от -90 мВ до +20 мВ (с шагом 10 мВ) в течение 60 с, за которым следовали 100 интервал мс при удерживающем потенциале.Второй импульс до −5 мВ в течение 10 мс позволил измерить имеющийся ток. И для быстрой, и для медленной инактивации пиковый ток, зарегистрированный во время второго импульса, был нормализован до максимального пика тока, и данные были подогнаны с помощью уравнения Больцмана I / Imax = 1 / (1+ (exp ((V − V 1/2 ) / k)), где V 1/2 — потенциал, при котором половина каналов Na v инактивирована, а k — коэффициент наклона [23]. Для восстановления после экспериментов по инактивации Na + токи генерировались по двухимпульсному протоколу, начиная с первого импульса до -5 мВ в течение 50 мс, за которым следует второй импульс до -5 мВ в течение 14.5 мс. Длительность между двумя импульсами увеличивалась на 1 мс для каждого набора двойных импульсов, и каждый набор разделялся на 10 с. Частичное восстановление рассчитывали путем деления максимальной амплитуды тока второго испытательного импульса на максимальную амплитуду тока соответствующего первого импульса. Данные восстановления соответствовали следующему экспоненциальному уравнению: I = I 0 + (Imax − I 0 ) * (1 − exp (−k * (t − t 0 ))), где k — константа скорости, а t — время (программное обеспечение GraphPad; название уравнения: плато, за которым следует одно уравнение связи фаз).

Анализаторы чувствительности к DCJW и лидокаину

Ооциты перфузировали 2 мкМ DCJW (DPX-JT333, согласно Соглашению о передаче материала между Университетом Анже и DuPont Crop Protection, Ньюарк, США) в течение 45 мин. Перед перфузией DCJW было выполнено несколько стабильных записей. Ооциты перфузировали 2 мМ лидокаином (Sigma-Aldrich) в течение 10 минут, и блокаду каналов Na + измеряли при -5 мВ. Затем измеряли соотношение тока пика Na + после перфузии лидокаином и сравнивали с контрольным пиком.Описанные выше протоколы активации, медленной и быстрой инактивации в стационарном состоянии и восстановления после быстрой инактивации также выполнялись после применения лекарства.

Анализ экспрессии белков с использованием конфокальной лазерной сканирующей микроскопии

Для экспериментов конфокальной микроскопии использовали ооциты альбиносов Xenopus . Для обнаружения вспомогательных субъединиц с помощью ПЦР вводили гистидиновую метку (RGHHHHHH) на 5′-конце конструкций PaTEh2A и PaTEh2B. Через пять дней после инъекции водой или 3 нг РНК, кодирующей DmNa v 1.1 и PaTEh2A или PaTEh2B, ооциты фиксировали в фосфатно-солевом буфере (PBS), содержащем 2% параформальдегида, в течение 30 минут при 4 ° C. Фиксированные ооциты промывали PBS и блокировали в PBS-Triton (PBS-T) 0,2% рыбьего желатина в течение 1 ч при комнатной температуре. Затем ооциты инкубировали 10 ч при 4 ° C с антителом RGS-His мыши (разведение 1-500; Qiagen) и кроличьим антителом Anti-Pan Na v (SP19) (1-100; Euromedex, Франция). Ооциты трижды промывали в PBS-T 0,2% в течение 5 минут, а затем инкубировали 90 минут с козьими антителами против мышиного IgG Alexa Fluor® 546 и козьими антителами против кроличьих IgG Alexa Fluor® 488 (разведение 1-3000, Invitrogen, США. ) и трижды промыли PBS.Ооциты помещали в чашки (там же, Мартинсрид, Германия) в растворе PBS / глицерин 5∶1 и отображали через объектив с числовой апертурой × 10 / 0,3 конфокального лазерного сканирующего микроскопа A1S1 Nikon (Nikon Instruments, Мелвилл, Нью-Йорк), снабженного аргоном. -ионный (488 нм) и диодный (561 нм) лазеры. Alexa Fluor® 488 возбуждали при 488 нм, и испускание флуоресценции собирали с использованием фильтра 500–550 нм; Alexa Fluor® 546 возбуждали на длине волны 561 нм, а испускание флуоресценции собирали с использованием фильтра 570-600 нм.Программное обеспечение ImajeJ (версия 1.4.3.67) использовалось для измерения относительной флуоресценции. Для количественной оценки относительной интенсивности флуоресценции для каждого тестируемого ооцита была выделена идентичная область размером 5002,2 мкм 2 и определено общее количество пикселей, соответствующих AlexaFluor® 488 или AlexaFluor® 546 в этой области. Флуоресценция не измерялась для контролей, в которых отсутствовали первичные антитела. Контроль специфичности иммуноокрашивания проводили с использованием той же процедуры в отдельных экспериментах: сначала с кроличьими анти-Pan Na v (SP19) и вторичными козьими антителами против мышиного IgG Alexa Fluor® 546, а во-вторых, с мышиным RGS-His и вторичными козьими антителами. Антитела против кроличьего IgG Alexa Fluor® 488.

Статистический анализ

Статистический анализ всех данных был выполнен с использованием программного обеспечения GraphPad Prism (версия 5). Все данные представлены как средние значения ± стандартная ошибка среднего (SEM). Тесты значимости между группами данных проводили с использованием дисперсионного анализа (односторонний дисперсионный анализ) с последующим апостериорным тестом Тьюки для сравнения всех групп или непарным тестом Стьюдента t . p Указано значений. Статистические вероятности выражаются как * p <0.05, ** p <0,01 и *** p <0,001.

Результаты

Анализ клонов кДНК раскрывает возможное удерживание интронов в транскрипте PaTEh2

Поскольку последовательность генома Periplaneta americana не доступна в базах данных, была проведена стандартная стратегия RT-PCR для клонирования кДНК, кодирующих гомолог DmTEh2 в нервной хорде P. americana . Вкратце, с использованием вырожденных праймеров P-S1 и P-R1 (таблица 1), сконструированных из консервативных аминокислотных областей, выведенных из выравнивания субъединиц TEh2 Drosophila melanogaster (номер доступа Genbank NP_649959), Anopheles gambiae (номер доступа) XP_310354 , Apis mellifera (номер доступа XP_001120804), Nasonia vitripennis (номер доступа XP_001606835) и Tribolium castaneum (номер XP_969821), был амплифицирован фрагмент кДНК длиной 561 п.н.Бласт-анализ показал, что выведенная аминокислотная последовательность этой кДНК имеет 51% идентичности последовательности с внеклеточной петлей DmTEh2, и, таким образом, она была идентифицирована как TEh2-подобный белок P. americana (PaTEh2). Эта частичная кДНК PaTEh2 позволила нам сконструировать специфические праймеры для экспериментов с 5′- и 3′-RACE. В эксперименте с 5′-RACE мы получили фрагмент кДНК длиной 986 п.н., содержащий 432 п.н. ORF и 554 п.н. из 5′-нетранслируемой области (5’UTR). Амплификация 3’RACE привела к идентификации двух фрагментов кДНК длиной 618 и 712 пар оснований.Последовательность длинного фрагмента отличалась от последовательности короткого только вставкой 94 п.н. на 37 п.н. выше стоп-кодона короткого фрагмента. Это указывало на присутствие двух транскриптов с разными 3′-концами ORF. Фрагмент 618 п.н. содержал последние 197 п.н. первой ORF; за которым следует 3’UTR размером 421 п.н., и фрагмент 712 п.н. содержит последние 194 п.н. второй ORF, за которыми следует 3’UTR 518 п.н. Обе последовательности 3’UTR проявляли полиА-хвост без консенсусного сайта полиаденилирования «AATAAA».Наконец, используя пару праймеров, охватывающих ORF, мы амплифицировали две разные кДНК. Десять клонов содержали ORF размером 843 п.н., кодирующую белок из 280 аминокислот, названный PaTEh2A (номер доступа KC206367). Шесть других клонов показали более длинную вставку (937 п.н.), содержащую ORF из 840 п.н., кодирующую белок из 279 аминокислот, названный PaTEh2B (номер доступа KC206368). Нуклеотидная последовательность клонов PaTEh2B соответствовала PaTEh2A , но со вставкой 94 п.н. после положения 807.Эта вставка размером 94 п.н. в последовательности PaTEh2B содержала новый стоп-кодон и изменяла кодирующую последовательность 3′-конца, что приводило к выведенному аминокислотному белку, PaTEh2B, который отклонялся от последовательности PaTEh2A только на последние 11 остатков своих С-концов. (Рисунок 1A). Эти данные показали, что PaTEh2A и PaTEh2B , вероятно, являются результатом альтернативного механизма сплайсинга одного гена.

Рис. 1. Анализ первичной структуры TEh2-подобных вспомогательных субъединиц P.американа .

A. Выравнивание Clustal W PaTEh2A (инвентарный номер GenBank KC206367), PaTEh2B (инвентарный номер KC206368) и DmTEh2 (инвентарный номер NP_649959). Трансмембранные сегменты (M1 и M2) обозначены жирной линией над последовательностями. Консервативные сайты N-гликозилирования обозначены закрытыми перевернутыми треугольниками (), а сайты O-гликозилирования субъединиц PaTEh2s указаны звездочкой (*) (www.cbs.dtu.dk). Пробелы обозначены тире. Ундекапептид (VALLDCEEDRT) и декапептид (YVPLSVHDTR) на С-концевых концах вариантов PaTEh2 заключены в рамку.Б. Профиль гидрофобности и предполагаемая топологическая организация PaTEh2A и PaTEh2B. Анализ гидрофобности выполняли с использованием алгоритма Кайт и Дулиттл (1982). Положение аминокислотных остатков отложено по оси x, а рассчитанная средняя гидрофобность отложена по оси y. Области над линией гидрофобны. Два предполагаемых сегмента, охватывающих мембрану, обозначены как M1 и M2.

https://doi.org/10.1371/journal.pone.0067290.g001

Анализ гидрофобности [24] аминокислотных последовательностей PaTEh2A и PaTEh2B (рис. 1B) выявил два гидрофобных домена (от положений 40 до 67 и от 225 до 243). ), который совмещен с предполагаемым трансмембранным доменом DmTEh2.Оба гидрофобных профиля перекрывались до аминокислотного остатка 269. Три варианта PaTEh2 содержали четыре предполагаемых сайта N-гликозилирования (остатки Asn в положениях 98, 135, 161 и 205), общие с DmTEh2 (остатки Asn в положениях 101, 129, 142). и 191) (Рисунок 1A). Двадцать предполагаемых сайтов O-гликозилирования (остатки Thr в положениях 137, 139, 141, 145, 147-155 и 163 и остатки Ser в положениях 138, 140, 142, 144, 146 и 157) были обнаружены в области между двумя мембранами. -протяжные домены вариантов PaTEh2 (рис. 1А).

Чтобы определить, были ли PaTEh2A и PaTEh2B результатом альтернативного сплайсинга, была проведена ПЦР с использованием геномной ДНК P. americana и праймеров, охватывающих ORF PaTEh2A . Был клонирован единственный ПЦР-фрагмент длиной 900 п.н., и его последовательность полностью совпала с последовательностью кДНК PaTEh2B . Вставка размером 94 п.н., которая отсутствовала в PaTEh2A , обнаруженная в этой частичной последовательности гена Pateh2 , была разделена донорными и акцепторными сайтами сплайсинга (рис. 2А).В то время как последовательность 5′-сайта сплайсинга соответствовала консенсусной последовательности, которая, как известно, способствует сплайсингу, последовательность 3′-сайта сплайсинга (tttttgtgctgtg) не соответствовала [25]. Этот 3′-сайт сплайсинга считался слабым, поскольку он содержал три необычных «G» (в положениях -8, -6 и -3) и заканчивался «TG» вместо высококонсервативного динуклеотида «AG» (рис. 2А). О необычном акцепторе сплайсинга TG сообщалось в генах как насекомых, так и млекопитающих [26], [27]. Дополнительная последовательность длиной 94 п.н., обнаруженная в гене Pateh2 , также показала консенсусный сайт ветвления (TAGCGAC) рядом с концом предполагаемого интрона.В заключение, если предположить, что только одна копия гена teh2 присутствует в геноме P. americana , вставка размером 94 п.н., скорее всего, соответствует интрону, который не сплицируется в PaTEh2B (рис. 2B). В целом эти наблюдения демонстрируют, что вариант PaTEh2B является результатом механизма удержания интронов.

Рисунок 2. Организация геномной области и мРНК, кодирующей TEh2-подобную субъединицу P. americana .

A. Геномная область Pateh2 состоит из двух экзонов, прерванных коротким интроном.Последовательность интрона написана строчными буквами, а донорный сайт сплайсинга, сайт разветвления и сайт акцептора сплайсинга подчеркнуты. Размеры экзонов и интрона указаны в скобках. *: стоп-кодон. B. Исключение или сохранение интрона привело к вариантам PaTEh2A и PaTEh2B с разными С-концевыми концами. Последовательность интрона 94 п.н. содержит новую короткую кодирующую последовательность, за которой следует стоп-кодон в кадре. Это генерирует второй белок (PaTEh2B) с новым С-концом.

https: // doi.org / 10.1371 / journal.pone.0067290.g002

Тканевое распределение транскриптов PaTEh2

Полуколичественные RT-PCR с использованием праймеров P-S3 и P-R3, охватывающих ORF, были выполнены для определения характера экспрессии транскриптов PaTEh2 в шести различных тканях. Во-первых, амплификация PaTEh2 кДНК была обнаружена в голове, грудных ганглиях и нервном канатике (Рисунок 3), что указывает на то, что PaTEh2 вариантов экспрессируются исключительно в нейрональных тканях.Гель агарозы показал две полосы с разной интенсивностью. Нижняя полоса идеально соответствовала PaTEh2A (ожидаемый размер: 843 п.н.), а верхняя полоса точно соответствовала PaTEh2B (ожидаемый размер: 936 п.н.). PaTEh2A -транскриптов оказалось меньше в голове, чем PaTEh2B . Напротив, транскриптов PaTEh2A экспрессировались на более высоких уровнях, чем PaTEh2B , как в грудных ганглиях, так и в нервном канатике.

Рисунок 3.Полуколичественный анализ RT-PCR экспрессии PaTEh2 в различных тканях P. americana .

ОТ-ПЦР выполняли с использованием 5 мкг мРНК, экстрагированной из головы, грудных ганглиев, нервного канатика, мышц, кишечника и добавочной железы в форме гриба. Актин (инвентарный номер Genbank AY116670) использовали в качестве внутреннего количественного контроля.

https://doi.org/10.1371/journal.pone.0067290.g003

Na

+ плотности тока модулируются вариантами PaTEh2 в ооцитах Xenopus

Мы сначала охарактеризовали токи Na + , вызванные экспрессией DmNa v 1-1 [22], отдельно или в комбинации с DmTEh2, PaTEh2A и PaTEh2B в ооцитах Xenopus (Рисунок 4).Ток не измерялся в ооцитах, инъецированных только с DmTEh2, PaTEh2A и PaTEh2B в качестве контроля (данные не показаны). Мы наблюдали, что необходимое количество РНК (от 1,8 до 35 нг) для регистрации токов Na + с соответствующими амплитудами (с максимальным пиком между 0,25 и 2 мкА) варьировалось в каждом случае. К сожалению, нам не удалось сравнить эти эффекты с коэкспрессией α-субъединицы Na v из P. americana [6] и DmTEh2, DmTipE, PaTEh2A или PaTEh2B, поскольку токи Na + не были обнаружены. даже после продолжительного времени инкубации (Рисунок S1).Как показано на фиг. 4A, 35 нг DmNa v 1-1 РНК вводили в ооциты для получения максимального пика ~ 0,25 мкА через десять дней без каких-либо вспомогательных субъединиц. С другой стороны, при совместной инъекции с DmTEh2 требовалось в 4,2 раза меньше РНК DmNa v 1-1 для получения максимального тока 0,4 мкА после 3-дневной инкубации, что указывает на шапероноподобный эффект, о котором сообщалось ранее [ 8]. Интересно, что этот эффект был значительно сильнее с PaTEh2A (1,2 мкА, 3-дневная инкубация) и PaTEh2B (0.6 мкА, 4-дневная инкубация), даже для меньшего количества введенных РНК (1,8 и 2,8 нг соответственно). Для точного сравнения шапероноподобного эффекта этих различных β-субъединиц плотности тока Na + измеряли как отношение максимальной плотности тока к количеству РНК после 3 дней инъекции (рис. 4B). По сравнению с DmTEh2 наиболее сильным шапероноподобным эффектом обладал PaTEh2A (6,3 раза, p <0,001), за ним следует PaTEh2B (2,8 раза, p <0,001). Мы также наблюдали уменьшение доли ооцитов, экспрессирующих детектируемые токи с PaTEh2B (~ 50%) по сравнению с PaTEh2A (~ 90%).PaTEh2A оказался более эффективным (в 2,2 раза, p <0,001), чем PaTEh2B, для увеличения плотности тока Na + . Поскольку оба они различались по последовательности только своими последними 11 аминокислотными остатками, уникальная модификация PaTEh2B была результатом новой С-концевой конечности, созданной механизмом удержания интрона. Усеченная форма PaTEh2s, лишенная 11 последних аминокислотных остатков (PaTEh2Δ (270-280)), модулировала плотности тока Na + аналогично PaTEh2A (рис. 4B). Идентичность высокой последовательности разделяет DmNa v 1 с PaNa v 1 (81%) и с каналом Na v немецкого таракана Blatella germanica , BgNa v 1 (77%) [6] привело нас к постулату, что последствия взаимодействия между α-субъединицей и вспомогательной субъединицей будут сохраняться у насекомых.Чтобы подтвердить это предположение, мы коэкспрессировали вариант BgNa v 1-1a, содержащий аналогичную организацию экзонов, как DmNa v 1-1, с PaTEh2A или PaTEh2B (Фигуры S2). Результирующие плотности тока Na + были примерно в два раза выше в ооцитах, экспрессирующих BgNa v 1-1a / PaTEh2A, чем BgNa v 1-1a / PaTEh2B, утверждая, что C-концевой конец PaTEh2B модулировал Drosophila . и экспрессия канала Na v таракана в аналогичной степени.В целом, наши данные показывают, что последние 11 аминокислотных остатков PaTEh2A не участвуют в шапероноподобных эффектах, а наличие уникальной С-концевой последовательности в PaTEh2B, кодируемой сохраненным интроном, мешает шапероноподобным свойствам.

Рис. 4. Модуляция плотностей тока Na + различными подтипами вспомогательных субъединиц TEh2.

A. Семейство токов Na + , измеренных при испытательных потенциалах от -70 мВ до 40 мВ при удерживающем потенциале -100 мВ для DmNa v 1-1 отдельно (α) или совместно с DmTEh2 (α + DmTEh2), PaTEh2A (α + PaTEh2A), PaTEh2B (α + PaTEh2B) или PaTEh2Δ (270-280) (α + PaTEh2Δ (270-280)), введенные примерно 35 нг, 8 нг, 2 нг, 3 нг и 2 нг. нг РНК (α∶β, 1∶1) соответственно.Показан протокол деполяризационных шагов фиксации напряжения. B. Плотность тока Na + на нг введенной РНК после 3-дневной инкубации, за исключением DmNa v 1-1 (10 дней после инъекции). Результаты выражены в мкА на нФ на нг введенной РНК (однофакторный дисперсионный анализ: F (4,55) = 15,11, p <0,0001, апостериорный тест Тьюки). Количество протестированных ооцитов указано в столбчатой ​​гистограмме.

https://doi.org/10.1371/journal.pone.0067290.g004

Чтобы оценить, отражает ли повышение плотности тока Na + увеличение накопления DmNa v 1-1 в ооцитах Xenopus На мембране мы разработали две конструкции Histag-PaTEh2A и PaTEh2B для двойного иммуноокрашивания.Мы гарантируем, что добавление N-концевой His-метки к PaTEh2A и PaTEh2B не изменило электрофизиологические свойства токов Na + , вызванных коэкспрессией с DmNa v 1-1, даже их шапероноподобные эффекты ( данные не показаны). На фиг.5А и 5В показаны иммунофлуоресцентные конфокальные изображения, записанные для ооцитов, инъецированных водой (отрицательный контроль) и DmNa v 1.1 вместе с РНК PaTEh2A или PaTEh2B. Данные показывают значительное увеличение (1,8 раза, p <0.01, фиг. 5C) в относительной интенсивности флуоресценции мембраны (Alexa®488 для DmNa v 1-1) в ооцитах, экспрессирующих DmNa v 1-1 / PaTEh2A, по сравнению с ооцитами, экспрессирующими DmNa v 1-1 / PaTEh2B. Это указывает на то, что PaTEh2A индуцирует более сильную экспрессию каналов DmNa v 1-1 в мембране ооцитов, чем PaTEh2B. Неожиданно мы также наблюдали более высокий уровень относительной интенсивности флуоресценции мембран (Alexa®546 для PaTEh2A или PaTEh2B) в ооцитах, инъецированных DmNa v 1-1 / PaTEh2B, чем DmNa v 1-1 / PaTEh2A РНК (2.2 раза, p <0,001, рис. 5C). Эти данные продемонстрировали, что C-концевой конец, кодируемый интронной последовательностью PaTEh2B, был ответственен за снижение плотности каналов DmNa v 1-1, предполагая, что механизм удержания интронов, вероятно, участвует в регуляции Na +. Экспрессия каналов в нейронах P. americana .

Рисунок 5. Модуляция экспрессии каналов Na v с помощью механизма удержания интронов teh2 , как гена P.американа .

Иммунофлуоресцентные конфокальные изображения репрезентативных ооцитов, инъецированных водой (контроль) или 3 нг DmNa v 1.1 / PaTEh2A (α + PaTEh2A) или PaTEh2B (α + PaTEh2B) РНК. A. Репрезентативный снимок иммунного окрашивания с антителом против Pan-Na v (Alexa®488) и связанные с ним каркасные графики, нарисованные с помощью программного обеспечения ImajeJ (версия 1.4.3.67). Б. Репрезентативный снимок иммуноокрашивания с антителом RGS-His (Alexa®546) и связанные с ним каркасные графики, нарисованные с помощью программного обеспечения ImajeJ.C. Относительную флуоресценцию измеряли с помощью программного обеспечения ImajeJ (версия 1.4.3.67). Для каждого измерения была определена идентичная представляющая интерес область размером 5002,2 мкм 2 (292 × 36 пикселей). Средние значения относительной интенсивности флуоресценции, измеренные с помощью Alexa®488 (белый) и Alexa®546 (серый), являются средними ± SEM для 6 ооцитов. PaTEh2A демонстрирует более сильную экспрессию α-субъединицы, чем PaTEh2B в ооцитах (односторонний дисперсионный анализ: Alexa®488: F (2,16) = 24,86, p <0,0001 и Alexa®546: F (2,15) = 39.81, p <0,0001, апостериорный тест Тьюки). a.u: условная единица.

https://doi.org/10.1371/journal.pone.0067290.g005

Биофизические свойства токов Na

+ модифицированы вариантами TEh2 в ооцитах Xenopus

Свойства активации и инактивации канала DmNa v 1-1, коэкспрессируемого с DmTEh2, PaTEh2A, PaTEh2B или PaTEh2Δ (270-280), представлены в таблице 2. Экспрессия только DmNa v 1-1 приводила к очень малая амплитуда тока при введении большого количества РНК (до 35 нг) и длительном времени инкубации (до 10 дней).Таким образом, мы не могли точно проанализировать токи Na + , вызванные только экспрессией DmNa v 1-1. На рисунке 6А показана зависимость от напряжения активации DmNa v 1-1 с помощью DmTEh2, PaTEh2A, PaTEh2B или PaTEh2Δ (270-280). Мы наблюдали значительный отрицательный сдвиг в зависимости активации PaTEh2A от напряжения по сравнению с DmTEh2 (8,1 мВ, p <0,001) и PaTEh2B (5,1 мВ, p <0,05) (Таблица 2). Напротив, зависимость активации от напряжения, регулируемая PaTEh2B, существенно не отличается от таковой для DmTEh2.Зависимость от напряжения активации токов Na + была положительно сдвинута в той же степени под действием PaTEh2B (3,6 мВ, p <0,01) при совместной экспрессии с BgNa v 1-1a по сравнению с PaTEh2A (рисунок S3A, таблица S1). Интересно, что зависимость от напряжения активации DmNa v 1-1 с помощью PaTEh2Δ (270-280) была аналогична таковой для DmNa v 1-1 / PaTEh2A. Это указывает на то, что 11-аминокислотный С-конец PaTEh2B модулирует активационные свойства токов Na + , но не PaTEh2A.

Рисунок 6. Биофизические свойства токов Na + , вызванных совместной экспрессией DmNa v 1-1 с DmTEh2 или PaTEh2-подобными субъединицами.

A. Зависимость активации от напряжения (односторонний дисперсионный анализ: F (3,65) = 6,67, p <0,0005, апостериорный тест Тьюки). G представляет собой проводимость. B. Зависимость от напряжения быстрой установившейся инактивации (однофакторный дисперсионный анализ: F (3,75) = 6,84, p = 0,0009, апостериорный тест Тьюки). В. Зависимость от напряжения медленной установившейся инактивации (однофакторный дисперсионный анализ: F (3,23) = 4.49, p = 0,014, апостериорный тест Тьюки). D. Восстановление после быстрой инактивации (однофакторный дисперсионный анализ: F (3,62) = 2,104, p = 0,1098, апостериорный тест Тьюки). Амплитуды тока Na + (I) были измерены с использованием импульсных протоколов, описанных в разделе «Материалы и методы», и нормированы на наибольшую амплитуду тока (Imax). Значения являются средними ± SEM. В скобках указано количество индивидуальных экспериментов, каждый из которых проводился с разными ооцитами. Стандартные протоколы показаны на вставках.

https://doi.org/10.1371/journal.pone.0067290.g006

Таблица 2. Параметры зависимости активации от напряжения и быстрой и медленной стационарной инактивации для DmNa v 1.1, коэкспрессируемой с DmTEh2, PaTEh2A , PaTEh2B или PaTEh2Δ (270-280) в ооцитах Xenopus в присутствии и в отсутствие лидокаина и DCJW.

https://doi.org/10.1371/journal.pone.0067290.t002

На рисунках 6B и 6C показаны зависимости от напряжения для установившейся быстрой и медленной инактивации.Зависимости от напряжения быстрой инактивации токов Na + существенно не различаются между DmNa v 1-1 / DmTEh2 и DmNa v 1-1 / PaTEh2B, а также между DmNa v 1-1 / PaTEh2A и DmNa v 1-1 / PaTEh2Δ (270-280) (таблица 2). По сравнению с PaTEh2B, как PaTEh2A, так и PaTEh2Δ (270-280) вызвали небольшие, но значимые отрицательные сдвиги в зависимости от напряжения быстрой инактивации (2,8 мВ и 2,9 мВ для PaTEh2A и PaTEh2Δ (270-280), соответственно, p <0.01). Напротив, между BgNa v 1-1a / PaTEh2A и BgNa v 1-1a / PaTEh2B не было обнаружено значительных различий в зависимости от напряжения быстрой инактивации (рисунок S3B, таблица S1). Также не изменилась зависимость медленной инактивации от напряжения между токами Na + , полученная с DmTEh2, PaTEh2B или PaTEh2Δ (270-280). Интересно, что PaTEh2A сдвинул зависимость медленной инактивации от напряжения в сторону более отрицательного потенциала по сравнению с DmTEh2 (-6,8 мВ, p <0,05), PaTEh2B (-6.1 мВ, не имеет значения) и PaTEh2Δ (270-280) (-5,0 мВ, p <0,05) (Таблица 2). Для всех комбинаций скорость восстановления, показанная на фиг. 6D, не показала существенной разницы (однофакторный дисперсионный анализ: F (3,60) = 2,104, p = 0,1098, апостериорный тест Тьюки) между различными TEh2.

Блокирующие эффекты ингибиторов каналов Na

v зависят от подтипа TEh2

Затем мы исследовали участие С-конца TEh2 в фармакологических свойствах каналов DmNa v 1-1.Во-первых, мы измерили ингибирование токов Na + LA, лидокаином (2 мМ) (рис. 7A и 7B). Интересно, что лидокаин вызывал достоверное (p <0,01) большее ингибирование токов Na + с PaTEh2B (44,8 ± 3,62%), чем с PaTEh2A (28,4 ± 2,97%). Существенной разницы между DmTEh2 (34,8 ± 2,58%) и PaTEh2A не наблюдалось. Мы также не обнаружили существенной разницы между PaTEh2B и PaTEh2Δ (270–280) (36,6 ± 2,9%). Эти данные показывают, что конкретный С-конец PaTEh2A (VALLDWEEDRT) играет роль в снижении текущей чувствительности Na + к лидокаину.Чтобы понять эти различия, мы проанализировали влияние лидокаина на свойства открытия канала Na + (рис. 8A – D). Лидокаин значительно сдвигал зависимость активации от напряжения в сторону деполяризующих потенциалов в каждом случае (рисунок 8A и таблица 2) на 9,3 мВ (PaTEh2A, p = 0,0036), 10,5 мВ (PaTEh2B, p = 0,0005), 5,7 мВ (DmTEh2, p = 0,0466) и 14,7 мВ (PaTEh2Δ (270-280), p = 0,008) по сравнению с контролем (таблица 2). Лидокаин также вызывал сдвиг зависимости быстрой инактивации от напряжения в сторону гиперполяризующих потенциалов: -3.4 мВ для PaTEh2A (p = 0,0340), -4,3 мВ для PaTEh2B (p = 0,0009), -3,0 мВ для DmTEh2 (p = 0,0280) и -3,3 мВ для PaTEh2Δ (270-280) (p = 0,0396) по сравнению с контроль. Точно так же лидокаин вызывает сдвиг в зависимости медленной инактивации от напряжения в сторону гиперполяризующих потенциалов: -15 мВ для PaTEh2A (p = 0,0121), -9,7 мВ для PaTEh2B (p = 0,0426), -14,2 мВ для DmTEh2 (p = 0,0069). и -16,5 мВ для PaTEh2Δ (270-280) (p = 0,0101). Лидокаин значительно увеличил постоянную времени восстановления после инактивации на 1.2 мс (PaTEh2A, p = 0,0006), 1,4 мс (PaTEh2B, p <0,0001), 0,8 мс (DmTEh2, p = 0,0338) и 1,1 мс (PaTEh2Δ (270-280), p = 0,0115) по сравнению с контролем. Лидокаин в одинаковой степени замедлял восстановление всех протестированных комбинаций каналов Na + (односторонний дисперсионный анализ: F (3,20) = 1,178, p = 0,35, апостериорный тест Тьюки). Кроме того, в присутствии лидокаина токи Na + частично восстанавливались, что означает частичное блокирование каналов Na + в состоянии инактивации (рис. 9A).Восстановление блокированных лидокаином токов Na + было значительно ниже (p <0,01) с PaTEh2A (87,08 ± 2,65%), чем с DmTEh2 (76,20 ± 1,85%), PaTEh2B (79,21 ± 1,54%) и (PaTEh2Δ (270 -280) (75,71 ± 1,29%) (Рисунок 9B).

Рисунок 7. Опосредованные изоформами TEh2 изменения чувствительности DmNa v 1-1 к ингибиторам каналов Na + .

A. Na + кривые тока, полученные с помощью деполяризующего импульса длительностью 20 мс до -10 мВ от удерживающего потенциала -100 мВ, в отсутствие (контроль, серый график) и в присутствии 2 мМ лидокаина через 10 мин. (черный след).B. Процент тонического ингибирования тока Na + , индуцированного лидокаином (2 мМ, 10 мин) для DmNa v 1-1, коэкспрессируемого с DmTEh2, PaTEh2A, PaTEh2B и PaTEh2Δ (270-280) (односторонний ANOVA: F (3,18) = 4,85, p <0,0121, апостериорный тест Тьюки). C. Токовые кривые Na + , полученные деполяризующим импульсом 20 мс до -10 мВ при удерживающем потенциале -100 мВ, в отсутствие (контроль, серая кривая) и в присутствии 2 мкМ DCJW через 30 мин (черный след). D. Процент ингибирования тока Na + в ответ на DCJW (2 мкМ, 30 мин) для DmNa v 1-1, коэкспрессируемого с DmTEh2, PaTEh2A, PaTEh2B и PaTEh2Δ (270-280) (односторонний ANOVA: F (3,22) = 13.22, p <0,0001, апостериорный тест Тьюки). Значения являются средними ± SEM. a.u: условная единица. Количество протестированных ооцитов указано в столбчатой ​​гистограмме.

https://doi.org/10.1371/journal.pone.0067290.g007

Рис. 8. Влияние лидокаина и DCJW на стробирующие свойства токов Na + .

Электрофизиологические свойства DmNa v 1-1, коэкспрессируемого с DmTEh2, PaTEh2A, PaTEh2B и PaTEh2Δ (270-280) в отсутствие (белый) и в присутствии 2 мМ лидокаина (черный) и 2 мкМ DCJW (серый ).A. Средние данные с SEM для V 1/2 активации. B. Средние данные с SEM для V 1/2 быстрой стационарной инактивации. C. Средние данные с SEM для V 1/2 медленной стационарной инактивации. D. Сводные данные о постоянной времени восстановления после быстрой деактивации. Статистические тесты были выполнены с использованием двухстороннего непарного t-критерия (контроль против лидокаина и контроль против DCJW). Количество протестированных ооцитов указано в столбчатой ​​гистограмме.

https: // doi.org / 10.1371 / journal.pone.0067290.g008

Рис. 9. Влияние лидокаина и DCJW на восстановление после быстрой инактивации токов Na + .

Протокол был таким же, как показано на рисунке 6D. A. Динамика восстановления после быстрой инактивации в присутствии 2 мМ лидокаина B. Столбики гистограммы, суммирующие эффекты 2 мМ лидокаина на скорость восстановления после быстрой инактивации через 20 мс. Данные были выведены из кривых, показанных в A (однофакторный дисперсионный анализ: F (3,19) = 7.71, p <0,0021, апостериорный тест Тьюки). C. Динамика восстановления после быстрой инактивации в присутствии 2 мкМ DCJW.

https://doi.org/10.1371/journal.pone.0067290.g009

Мы также оценили чувствительность DmNav1-1, коэкспрессируемого с четырьмя подтипами TEh2, к DCJW, активному метаболиту индоксакарба, который представляет собой Na + Инсектицид, направленный на канал [12], [13]. Токи Na + , полученные с DmTEh2, оказались более чувствительными (ингибирование 39,4 ± 3,6%) к DCJW (2 мкМ), чем токи, полученные с PaTEh2A (25.1 ± 2,1%, p <0,05), а в усеченной форме - PaTEh2Δ (270-280) (8,3 ± 1,9%, p <0,001) (рис. 7C и 7D). Напротив, не наблюдалось значительной разницы в чувствительности к DCJW между DmTEh2 и PaTEh2B (31,4 ± 7,1%). Таким образом, наши результаты показывают, что усечение 11 аминокислотных остатков на С-конце β-субъединиц TEh2 сильно снижает чувствительность каналов Na + к DCJW.

Мы также проанализировали влияние DCJW (2 мкМ) на стробирующие свойства каналов DmNa v 1-1.DCJW сдвинул зависимость активации от напряжения в сторону деполяризованных потенциалов на 8,7 мВ (p = 0,0036; фиг. 8A, таблица 2) только для DmNa v 1-1, коэкспрессируемого с PaTEh2B. Оказалось, что DCJW немного сместил зависимости от напряжения как для быстрой, так и для медленной инактивации токов Na + в сторону более отрицательных потенциалов (рис. 8B и 8C). Небольшой отрицательный сдвиг на -3,8 мВ и -3,9 мВ (p = 0,0034 и p = 0,0060) зависимости быстрой инактивации от напряжения наблюдался для PaTEh2A и PaTEh2B, соответственно (Таблица 2).Неожиданно мы наблюдали, что DCJW вызывает относительно большой сдвиг медленной инактивации в сторону гиперполяризованных потенциалов на -11,5 мВ (p = 0,0470) относительно токов Na + , полученных с PaTEh2B. DCJW значительно увеличивает постоянную времени восстановления после быстрой инактивации на 0,7 мс (DmTEh2, p <0,05) и на 1,1 мс (PaTEh2B, p <0,001) по сравнению с контролем, но не для PaTEh2A и PaTEh2Δ (270-280) (рис. 8D , Таблица 3). Однако эти эффекты аналогичны для DmTEh2 и PaTEh2B (p = 0.864, непарный t-тест).

В заключение, лидокаин вызывал аналогичные модификации активации, быстрой и медленной инактивации токов Na + независимо от того, какой вариант TEh2 коэкспрессируется. Что касается DCJW, то способ действия ингибирования и его влияние на гейтинг-свойства варьировали в зависимости от типа коэкспрессируемых вариантов TEh2. Подобно лидокаину, DCJW также замедлял скорость восстановления после быстрой инактивации каналов Na + , за исключением PaTEh2Δ (270-280).Примечательно, что лидокаин нарушил полное восстановление каналов Na + после импульса инактивации, в то время как DCJW этого не сделал (рис. 9C). Однако DCJW мало влиял на зависимость активации, быстрой и медленной инактивации от напряжения. Интересно, что C-концевой конец PaTEh2 модулирует действие DCJW, влияя на зависимость активации от напряжения и восстановление после быстрой инактивации. В целом, наши данные показывают участие вариантов TEh2 в модуляции блокирующего действия лидокаина и DCJW на каналы Na v насекомых.

Обсуждение

В этом исследовании впервые сообщается о последствиях механизма удержания интронов вспомогательных субъединиц нейрональных Na v каналов насекомых на регуляцию экспрессии каналов, стробирование и чувствительность к ингибиторам натриевых каналов. Мы обнаружили, что два TEh2-подобных варианта, PaTEh2A и PaTEh2B, исключительно и по-разному экспрессируются в нервной системе P. americana . В то время как PaTEh2A является сплайсированной формой, PaTEh2B является результатом механизма удержания интрона, превращающего ундекапептид в новый декапептид на С-конце белка.Это вызывает уменьшение плотности тока Na + , а также изменяет оба стробирующих свойства каналов Na + . Кроме того, наши результаты указали на заметные различия в механизме блокирования, вызванном лидокаином и DCJW. Чувствительность каналов Na + к LA и PTI, по-видимому, модулируется TEh2-подобными вариантами. Таким образом, процесс удержания интронов teh2-подобных генов представляет собой новый механизм, который способствует функциональному и фармакологическому разнообразию каналов Na v у насекомых.

Распределение TEh2-подобных субъединиц в нейронах

Распределение вариантов PaTEh2 в тканях совпадает с распределением PaNa v 1, который был обнаружен в различных тканях с разным уровнем экспрессии [6]. Однако, как сообщается для DmTEh2 [8], PaTEh2 экспрессируется исключительно в нейрональных тканях, указывая на то, что эти две гомологичные субъединицы участвуют в регуляции нейрональных каналов Na v . Поскольку D. melanogaster и P. americana филогенетически далеки друг от друга в большом порядке, мы можем разумно предсказать, что гомологи TEh2 других видов насекомых также экспрессируются исключительно в нейрональной ткани и могут составлять подсемейство вспомогательных субъединиц, участвующих в модуляции нейрональные каналы Na v .

Потенциальное сохранение события удержания интрона в вспомогательных субъединицах канала Na

v насекомых и млекопитающих

Мы показали, что ген Pateh2 имеет два экзона, экзон 1 и экзон 2, разделенные короткой последовательностью интрона, интроном 1. Экзон 2 короткий и кодирует последние 11 аминокислотных остатков С-концевого конца варианта PaTEh2A. Удержание интрона 1 приводит к короткой кодирующей последовательности с ранним стоп-кодоном в PaTEh2B , что приводит к новому С-концевому концу.Чтобы определить, встречается ли аналогичный механизм сплайсинга с удержанием интронов, нацеленный на C-конец TEh2, у других видов насекомых, мы исследовали доступные геномные последовательности в базе данных GenBank. teh2 Ген D. melanogaster содержит интрон переменной длины, который нарушает конец кодирующей последовательности (номер доступа Dmel_CG12806). К такому же выводу привел биоинформатический анализ генома N. vitripennis (инвентарный номер NC_015869).Аннотированы два варианта транскрипта, и они отличаются только концом своей 3′-кодирующей последовательности (номер доступа XM_003425719, вариант транскрипта 1 и XM_003425720, вариант транскрипта 2), что связано с присутствием первых 72 п.н. интрона 1 интрона ген (номер доступа LOC100123225), и ведущий к другому 24-аминокислотному С-концу. Поскольку только одна копия teh2-подобного гена была обнаружена в геноме N. vitripennis , TEh2-подобные варианты 1 и 2, указанные в GenBank, могут быть результатом механизма удерживания интронов.Бласт-анализ также выявил наличие двух бицистронных генов teh2 в геноме комара, Culex quinquefasciatus (номера доступа CpipJ_CPIJ006103 и CpipJ_CPIJ006104). Оба гена различаются длиной экзона 2 (13 и 85 пн). Соответственно, выведенные аминокислотные последовательности обоих транскриптов (номера доступа XM_001847934 и XM_001847935) различаются своей длиной и С-концом. В отношении D. melanogaster и Anopheles gambiae описаны только один ген и один транскрипт (номера доступа Dmel_CG12806 и AgaP_AGAP003797).Тем не менее, наличие короткой кодирующей последовательности с ранним стоп-кодоном в интронных последовательностях обоих генов предсказывает возможность сохранения процесса консервативного интрона у этих насекомых. Следовательно, мы предполагаем, что механизм удержания интронов может быть общим механизмом, позволяющим генерировать молекулярную изменчивость TEh2-подобных белков.

Механизм сплайсинга за счет удержания интронов относительно редок и встречается менее чем у 5% как у позвоночных, так и у беспозвоночных [28], [29]. При транскрипции генов SCN1B млекопитающих задокументированы два события удержания интронов.Первый касается удержания интрона 5 крысиного SCN1B и не меняет кодирующую последовательность [30]. Второй механизм включает удержание интрона 3, как сообщается в генах SCN1B как крысы, так и человека [31], [32]. В этом случае, как и в случае с PaTEh2, событие удержания интрона генерирует два белка с различными С-концевыми концами, связанными с токами Na + с различными свойствами. Эти данные демонстрируют, что функциональная регуляция канала Na v посредством альтернативного сплайсинга генов вспомогательных субъединиц является консервативным процессом у млекопитающих и насекомых.

Последствия механизма удержания интронов на биофизические свойства канала Na

v

Несплицированный вариант PaTEh2B вызывал снижение плотности тока в 2,2 раза, что сопровождалось эквивалентным увеличением включения α-субъединицы в плазматическую мембрану, по сравнению с PaTEh2A. Цитоплазматический С-конец TEh2-подобных субъединиц вряд ли участвует в усиленной экспрессии каналов Na v , о чем свидетельствуют сходные плотности тока Na + с коэкспрессией PaTEh2A или укороченной конструкции с С-концом.С другой стороны, новый C-концевой конец PaTEh2B, генерируемый в процессе удержания интрона, приводит к снижению плотности тока Na + . Это, вероятно, является результатом уменьшения i) количества ооцитов, экспрессирующих детектируемые токи и ii) накопления α-субъединицы в мембранах ооцитов, даже если уровень экспрессии на мембране PaTEh2B выше, чем PaTEh2A. Мы предполагаем, что накопление PaTEh2B в мембране токсично для ооцитов. Мы также не можем исключить, что новый C-концевой конец PaTEh2B взаимодействует с др. Мембранными белками во время своего транспорта и тем самым снижает доступность PaTEh2B для адресации α-субъединицы DmNa v 1-1 к мембране.

Здесь мы показали, что активационные и инактивационные свойства DmNa v 1-1 зависят от связанных вспомогательных субъединиц. В присутствии DmTEh2, PaTEh2A, PaTEh2B или укороченного PaTEh2, лишенного последних 11-аминокислотных остатков, токи Na + демонстрируют небольшие различия в зависимости от потенциала быстрой инактивации. Это указывает на то, что С-концевая область этих белков не участвует в модуляции быстрой инактивации. Однако, в то время как V 1/2 медленной инактивации аналогичен DmTEh2, PaTEh2B и усеченному PaTEh2, PaTEh2A сдвигает зависимость медленной инактивации от напряжения в гиперполяризованном направлении.В совокупности мы предполагаем, что С-концевой конец PaTEh2A (VALLDWEEDRT) модулирует только свойства медленной инактивации, тогда как один из PaTEh2B (YVPLSVHDTR) — нет. Что касается модуляции свойств активации канала, с PaTEh2A и усеченным PaTEh2, зависимость активации канала от напряжения не изменяется, тогда как с PaTEh2B зависимость активации канала от напряжения смещена в деполяризованном направлении. Таким образом, С-конец PaTEh2B участвует в модуляции активации канала.Интересно, что изменение С-конца в β1A крысы также приводит к сдвигу зависимостей активации и инактивации от напряжения в более деполяризованном направлении [31]. В совокупности механизм удержания интронов, по-видимому, представляет собой новый механизм, который может регулировать возбудимость нейронов путем тонкой модуляции уровня экспрессии, активации и медленной инактивации каналов Na v у тараканов. TEh2 и TEh2-подобные варианты сдвигают зависимость от напряжения как активации, так и инактивации токов Na + в сторону более отрицательных потенциалов по сравнению с TipE [22].Более того, кинетика активации и инактивации токов Na + ускоряется с помощью TEh2 (данные не показаны). Поскольку все исследования, пытающиеся охарактеризовать варианты каналов Na v свойств D. melanogaster и B. germanica , были выполнены с использованием TipE, мы прогнозируем, что другие субъединицы могут резко изменить кинетические и стробирующие свойства этих вариантов. Аналогичные последствия конверсии С-конца TEh2 наблюдались для каналов Na v из D.melanogaster и B. germanica убедительно свидетельствуют о том, что модуляция токов Na + сплайсингом TEh2 не зависит от происхождения α-субъединицы. Это свидетельствует в пользу высококонсервативной функции вспомогательной субъединицы у насекомых.

Последствия механизма удержания интронов на фармакологические свойства канала Na

v

Тоническая блокада лидокаином вызвана связыванием с состоянием покоя каналов Na v с более низким сродством [17], [18].Здесь мы показываем, что лидокаин связывается с Drosophila покоящихся каналов Na v и индуцирует заметный деполяризующий сдвиг в зависимости активации от напряжения, указывая на сильную зависимость от напряжения лидокаинового блока, как описано ранее [18]. Этот эффект можно объяснить его взаимодействием с S4-сегментами доменов III и IV [33]. Положительный сдвиг активации лидокаином V 1/2 уже был зарегистрирован для млекопитающих Na v 1,5 и Na v 1.8, но не для Na v 1,7 [34], [35]. Кроме того, фазическая блокада лидокаином объясняется преимущественным связыванием с инактивированным состоянием каналов Na v [18]. Согласно этому утверждению, наши результаты показывают, что лидокаин вызывает сдвиг влево зависимости от напряжения как для быстрой, так и для медленной инактивации. Они также хорошо согласуются с предыдущими исследованиями, показывающими, что механизм ингибирования лидокаина действует путем стабилизации как быстро-, так и медленно-инактивированного состояния [36], [37]. Это было усилено более медленной скоростью восстановления быстрой инактивации лидокаин-блока DmNa v 1-1 каналов.Неожиданно наши данные показывают, что каналы DmNa v 1-1 не полностью восстанавливаются при блокаде лидокаина от быстрой инактивации в стационарных условиях. Нарушение восстановления каналов Na + после инактивирующего импульса пока не зарегистрировано. Это указывает на то, что часть лидокаина-DmNa v 1-1 остается в инактивированном состоянии. Что еще более интересно, наши данные также сообщают, что каналы Na против не одинаково чувствительны к лидокаину в зависимости от гомологов TEh2, коэкспрессированных с одной и той же α-субъединицей.Более низкая чувствительность DmNa v 1-1 к лидокаину наблюдается с PaTEh2A, для которого нижняя часть DmNa v 1-1 блокируется лидокаином в инактивированном состоянии по сравнению с другими вспомогательными субъединицами. Идея о том, что взаимодействие α / β-субъединиц решающим образом определяет фармакологию каналов Na v насекомых, является логичным предположением, как сообщается в отношении эффектов лидокаина на каналы Na v млекопитающих [38], [39], [40]. Таким образом, наши результаты показывают, что механизм блокады лидокаинового канала, по-видимому, сходен для каналов Na v как насекомых, так и млекопитающих, и расширяет недавно опубликованное исследование [41].

DCJW не влияет на зависимость от напряжения активации токов Na + , вызываемых DmNa v 1-1 / DmTEh2 или DmNa v 1-1 / PaTEh2A, ко-экспрессией в ооцитах Xenopus . Это согласуется с предыдущими сообщениями, выполненными как в ооцитах Xenopus , трансфицированных каналом Na v немецкого таракана [42], так и в нативных нейронах DUM P. americana [13], [14]. Неожиданно в присутствии варианта PaTEh2B мы показали, что DCJW модифицирует активацию тока Na + .Таким образом, мы предполагаем, что модификация активации DCJW зависит от комбинации α-субъединица / вспомогательная субъединица. Мы также показываем, что DCJW не влияет на зависимость быстрой инактивации от напряжения, как уже сообщалось [16], [42]. В отличие от предыдущих наблюдений, наши данные показывают, что DCJW умеренно сдвигает зависимости от напряжения быстрой и медленной инактивации токов Na + , вызванных коэкспрессией DmNa v 1-1 с гомологами TEh2. Интересно, что зависимость от напряжения медленной инактивации тока Na + , вызванная коэкспрессией PaTEh2B и DmNa v 1-1, оказывается более чувствительной к DCJW.Это указывает на то, что каналы Na v , образованные DmNa v 1-1 / PaTEh2B, проявляют отчетливое свойство медленной инактивации, подтверждая гипотезу о том, что C-конец, генерируемый удерживанием интрона, взаимодействует с областью α-субъединицы, участвующей в медленной инактивации.

Идея, что LA и PTIs блокируют каналы Na v с помощью сходных механизмов, частично основана на доказательствах, что лидокаин и DCJW, возможно, имеют общий или перекрывающийся сайт связывания на каналах Na v насекомых [13].Эксперименты по сайт-направленному мутагенезу показали, что два ключевых LA-взаимодействующих остатка, идентифицированные в каналах Na v млекопитающих, важны, но не критичны для связывания лидокаина и механизма действия на каналы Na v насекомых [41]. Наши результаты также указывают на заметные различия в механизмах, с помощью которых лидокаин и DCJW блокируют каналы Na v насекомых. В то время как лидокаин вызывает заметный деполяризующий сдвиг зависимости активации от напряжения, DCJW оказывает слабое влияние на свойство активации.Кроме того, лидокаин оказывает более выраженное влияние на быструю и медленную инактивацию в устойчивом состоянии, чем DCJW. Воспроизведение связанных с лекарством каналов DmNa v 1-1 происходит медленно из-за сильных стабилизирующих эффектов инактивированного состояния обеими молекулами, но лидокаин, по-видимому, блокирует канал в этом состоянии. Таким образом, ингибирующие эффекты лидокаина и DCJW не одинаково чувствительны к потенциалу. Наконец, лидокаин ведет себя больше как модификатор блокировки каналов Na v насекомых с очень сложным механизмом.

В заключение, наша работа демонстрирует, что вспомогательные субъединицы каналов Na + насекомых могут подвергаться процессу удержания интронов, который представляет собой непредвиденный механизм, который модулирует электрическую возбудимость нейронов путем настройки экспрессии, стробирования и фармакологических свойств Na v. каналов. Этот механизм модуляции происходит за счет преобразования C-конца TEh2-подобных белков у американских тараканов. Наши результаты убедительно свидетельствуют о том, что этот механизм, вероятно, может иметь место у других видов насекомых, таких как D.melanogaster . Для подтверждения этой гипотезы необходимы поиск варианта TEh2 и нейрональная характеристика гена teh2 у мутанта D. melanogaster . Кроме того, наши результаты ясно показывают, что более нецелесообразно исследовать механизмы, лежащие в основе механизма действия инсектицидов, нацеленных на каналы Na v , без учета сложных взаимодействий между порообразующими и вспомогательными субъединицами. Хотя это исследование было сосредоточено на PTI, мы полагаем, что исследование вспомогательных субъединиц канала Na v должно быть распространено на другие семейства инсектицидов, такие как пиретроиды.Подтверждая это, недавние данные показали, что у млекопитающих каналы Na v 1.3 и Na v 1.6 проявляют разную чувствительность к пиретроидам при совместной экспрессии с субъединицами β1 и β2 крыс или отдельно [43], [44].

Дополнительная информация

Рисунок S1.

Экспрессия каналов PaNa v 1 с вспомогательными субъединицами и без них. На этом рисунке показаны текущие следы, полученные при экспрессии в ооцитов Xenopus каналов PaNa v 1 с вспомогательными субъединицами и без них (DmTipE, DmTEh2, PaTEh2A и PaTEh2B).Во всех случаях не наблюдалось никаких токов, зависящих от напряжения. Токи семейства Na + были измерены при испытательных потенциалах от -70 мВ до 40 мВ от удерживающего потенциала -100 мВ. A. Никаких токов не было обнаружено после инъекции одного PaNa v 1 (11 нг РНК, 6-дневная инкубация) или с DmTEh2 (13,5–27 нг РНК, 8-дневная инкубация), DmTipE (7,4 нг РНК, 11-дневная инкубация). инкубация), PaTEh2A (7,4 нг РНК, 10-дневная инкубация) и PaTEh2B (5,5 нг РНК, 3-дневная инкубация).

https: // doi.org / 10.1371 / journal.pone.0067290.s001

(PDF)

Рисунок S2.

Модуляция плотности тока Na + канала BgNav вспомогательными субблоками PaTEh2A и PaTEh2B. На этом рисунке показаны семейства токов Na + , зарегистрированные при различных тестовых потенциалах в ооцитах Xenopus , инъецированных только с каналами BgNa v 1-1 и с вариантами PaTEh2A или PaTEh2B. Результирующие плотности тока Na + при -5 мВ нанесены на гистограмму.А. Экспрессия каналов BgNa v 1-1a с вспомогательными субъединицами и без них. Токи семейства Na + были измерены при испытательных потенциалах от -70 мВ до 40 мВ от удерживающего потенциала -100 мВ. B. Токи Na + получали после инъекции 10 нг мРНК и 3-дневной инкубации только BgNa v 1-1a или с PaTEh2A и PaTEh2B. Плотность тока Na + на нг введенной РНК после 3-дневной инкубации. Результаты выражаются в мкА на нФ на нг введенной РНК (однофакторный дисперсионный анализ: F (2,30) = 42.94, p <0,0001 апостериорный тест Тьюки). Количество протестированных ооцитов указано в столбчатой ​​гистограмме.

https://doi.org/10.1371/journal.pone.0067290.s002

(PDF)

Рисунок S3.

Биофизические свойства токов Na + , вызванных совместной экспрессией BgNa v 1-1a с субъединицами PaTEh2A или PaTEh2B. На этом рисунке показана зависимость от напряжения активации и быстрой стационарной инактивации токов Na + , вызванных коэкспрессией BgNa v 1-1a с субъединицами PaTEh2A или PaTEh2B.A. Зависимость активации от напряжения. G представляет собой проводимость. B. Зависимость от напряжения быстрой установившейся инактивации. Значения являются средними ± SEM. В скобках указано количество индивидуальных экспериментов, каждый из которых проводился с разными ооцитами.

https://doi.org/10.1371/journal.pone.0067290.s003

(PDF)

Благодарности

Мы признательны доктору Эрве Ле Корронку за его полезные советы относительно конфокальной визуализации. Мы благодарим Сельму Кейн за критическое прочтение рукописи.Мы очень благодарим доктора Даниэля Кордову за предоставление инсектицидного соединения DCJW.

Вклад авторов

Задумал и спроектировал эксперименты: CMB CL. Проведены эксперименты: CMB BM CL LM SQ MJ LW. Проанализированы данные: CMB BM CL NCG LW. Предоставленные реагенты / материалы / инструменты для анализа: CMB BM CL LM SQ MJ BL LW. Написал документ: CMB CL KD NCG.

Ссылки

  1. 1. Хилле Б. (2001) Ионные каналы возбудимых мембран. . Sinauer Associates, Inc, Сандерленд, Массачусетс.
  2. 2. Catterall WA, Goldin AL, Waxman SG (2005) Международный фармакологический союз. XLVII. Номенклатура и взаимосвязь между структурой и функцией натриевых каналов, управляемых напряжением. Pharmacol Rev 57: 397–409.
  3. 3. Сильвер К.С., Содерлунд Д.М. (2005) Действие инсектицидов пиразолинового типа на сайты-мишени нейронов. Pestic Biochem Physiol 81: 136–143.
  4. 4. Дэвис Т.Г., Филд Л.М., Ашервуд П.Н., Уильямсон М.С. (2007) ДДТ, пиретрины, пиретроиды и натриевые каналы насекомых.IUBMB Life 59: 151–162.
  5. 5. Гольдин А.Л. (2002) Эволюция потенциалзависимых Na (+) каналов. J Exp Biol 205: 575–584.
  6. 6. Moignot B, Lemaire C, Quinchard S, Lapied B, Legros C (2009) Открытие нового натриевого канала у таракана Periplaneta americana: свидетельство ранней дупликации параподобного гена. Биохимия насекомых, биол 39: 814–823.
  7. 7. Isom LL (2001) Бета-субъединицы натриевых каналов: все, кроме вспомогательных. Невролог 7: 42–54.
  8. 8. Derst C, Walther C, Veh RW, Wicher D, Heinemann SH (2006) Четыре новые последовательности в Drosophila melanogaster, гомологичные вспомогательной субъединице Para натриевого канала TipE. Biochem Biophys Res Commun 339: 939–948.
  9. 9. Feng G, Deak P, Chopra M, Hall LM (1995) Клонирование и функциональный анализ TipE, нового мембранного белка, который усиливает функцию пара-натриевых каналов дрозофилы. Ячейка 82: 1001–1011.
  10. 10. Warmke JW, Reenan RA, Wang P, Qian S, Arena JP и др.(1997) Функциональная экспрессия пара-натриевых каналов дрозофилы. Модуляция мембранным белком TipE и фармакология токсина. J Gen Physiol 110: 119–133.
  11. 11. Сильвер К.С., Сонг В., Номура Ю., Сальгадо В.Л., Донг К. (2010) Механизм действия инсектицидов, блокирующих натриевые каналы (SCBI), на натриевые каналы насекомых. Биохимия и физиология пестицидов 97: 87–92.
  12. 12. Wing D, Sacher M, Kagaya Y, Tsurubuchi Y, Mulderig L. и др. (2000) Биоактивация и механизм действия оксадиазининдоксакарба у насекомых.Защита посевов 19: 537–545.
  13. 13. Lapied B, Grolleau F, Sattelle DB (2001) Индоксакарб, оксадиазиновый инсектицид, блокирует нейронные натриевые каналы насекомых. Br J Pharmacol 132: 587–595.
  14. 14. Zhao X, Ikeda T, Salgado VL, Yeh JZ, Narahashi T (2005) Блокировка двух подтипов натриевых каналов в нейронах тараканов инсектицидами индоксакарба. Нейротоксикология 26: 455–465.
  15. 15. Сальгадо В.Л. (1992) Медленная вольт-зависимая блокада натриевых каналов в нерве рака дигидропиразольными инсектицидами.Мол Pharmacol 41: 120–126.
  16. 16. Song W, Liu Z, Dong K (2006) Молекулярные основы дифференциальной чувствительности натриевых каналов насекомых к DCJW, биоактивному метаболиту оксадиазинового инсектицида индоксакарба. Нейротоксикология 27: 237–244.
  17. 17. Хилле Б. (1977) Местные анестетики: гидрофильные и гидрофобные пути реакции лекарство-рецептор. J Gen Physiol 69: 497–515.
  18. 18. Bean BP, Cohen CJ, Tsien RW (1983) Лидокаиновая блокада сердечных натриевых каналов.J Gen Physiol 81: 613–642.
  19. 19. Lavialle-Defaix C, Gautier H, Defaix A, Lapied B, Grolleau F (2006) Дифференциальная регуляция двух разных напряженно-зависимых натриевых токов активацией метаботропных рецепторов глутамата группы III в нейронах водителя ритма насекомых. J Neurophysiol 96: 2437–2450.
  20. 20. Lavialle-Defaix C, Moignot B, Legros C, Lapied B (2010) Как кальций-зависимая внутриклеточная регуляция потенциалзависимого натриевого тока увеличивает чувствительность к декарбометоксилированному метаболиту индоксакарба оксадиазинового инсектицида JW062 (DCJW) в нейронах водителя ритма насекомых? J Pharmacol Exp Ther 333: 264–272.
  21. 21. Блин Н., Стаффорд Д.В. (1976) Общий метод выделения высокомолекулярной ДНК из эукариот. Nucleic Acids Res 3: 2303–2308.
  22. 22. Olson RO, Liu Z, Nomura Y, Song W, Dong K (2008) Молекулярная и функциональная характеристика вариантов потенциал-управляемых натриевых каналов от Drosophila melanogaster. Биохимия насекомых, биол 38: 604–610.
  23. 23. Барела А.Дж., Вадди С.П., Ликфетт Дж. Г., Хантер Дж., Анидо А. и др. (2006) Эпилептическая мутация в натриевом канале SCN1A, которая снижает возбудимость канала.J Neurosci 26: 2714–2723.
  24. 24. Кайт Дж., Дулиттл Р.Ф. (1982) Простой метод отображения гидропатического характера белка. J Mol Biol 157: 105–132.
  25. 25. Cartegni L, Chew SL, Krainer AR (2002) Слушать молчание и понимать бессмыслицу: экзонные мутации, влияющие на сплайсинг. Нат Рев Генет 3: 285–298.
  26. 26. Бурине Э., Сунг Т.В., Саттон К., Слеймейкер С., Мэтьюз Э. и др. (1999) Сплайсинг субъединицы альфа 1A генерирует фенотипические варианты кальциевых каналов P- и Q-типа.Nat Neurosci 2: 407–415.
  27. 27. Шафрански К., Шиндлер С., Таудиен С., Хиллер М., Хусе К. и др. (2007) Нарушение правил сплайсинга: динуклеотиды TG функционируют как альтернативные 3′-сайты сплайсинга в U2-зависимых интронах. Геном Биол 8: R154.
  28. 28. Ким Э., Горен А., Аст Г. (2008) Альтернативное сращивание: текущие перспективы. Биологические исследования 30: 38–47.
  29. 29. Khodor YL, Rodriguez J, Abruzzi KC, Tang CH, Marr MT 2nd, et al. (2011) Nascent-seq указывает на широко распространенный котранскрипционный сплайсинг пре-мРНК у дрозофилы.Genes Dev 25: 2502–2512.
  30. 30. Диб-Хадж С.Д., Ваксман С.Г. (1995) Гены, кодирующие бета-1-субъединицу потенциал-зависимого Na + -канала крысы, мыши и человека, содержат консервативные интроны. FEBS Lett 377: 485–488.
  31. 31. Казен-Гиллеспи К.А., Рэгсдейл Д.С., Д’Андреа М.Р., Маттей Л.Н., Роджерс К.Э. и др. (2000) Клонирование, локализация и функциональная экспрессия субъединиц бета1А натриевых каналов. J Biol Chem 275: 1079–1088.
  32. 32. Qin N, D’Andrea MR, Lubin ML, Shafaee N, Codd EE и др.(2003) Молекулярное клонирование и функциональная экспрессия субъединицы β1B натриевого канала человека, нового варианта сплайсинга субъединицы β1. Eur J Biochem 270: 4762–4770.
  33. 33. Sheets MF, Hanck DA (2003) Молекулярное действие лидокаина на датчики напряжения натриевых каналов. J Gen Physiol 121: 163–175.
  34. 34. Chevrier P, Vijayaragavan K, Chahine M (2004) Дифференциальная модуляция натриевых каналов периферических нервов Nav1.7 и Nav1.8 местным анестетиком лидокаином.Br J Pharmacol 142: 576–584.
  35. 35. Fan XR, Ma JH, Zhang PH, Xing JL (2010) Блокирующее действие метилфлавоноламина на каналы Na (V) 1.5 человека, экспрессируемые в ооцитах Xenopus laevis, и на натриевые токи в миоцитах желудочков кролика. Acta Pharmacol Sin 31: 297–306.
  36. 36. Balser JR, Nuss HB, Romashko DN, Marban E, Tomaselli GF (1996) Функциональные последствия связывания лидокаина с медленно инактивированными натриевыми каналами. J Gen Physiol 107: 643–658.
  37. 37.Чен З., Онг Б.Х., Камбурис Н.Г., Марбан Э., Томаселли Г.Ф. и др. (2000) Лидокаин вызывает медленное инактивирование натриевых каналов скелетных мышц крыс. J Physiol 524 Pt 1: 37–49.
  38. 38. Makielski JC, Limberis J, Fan Z, Kyle JW (1999) Внутреннее сродство лидокаина к Na-каналам, экспрессируемым в ооцитах Xenopus, зависит от субъединиц альфа (hh2 против rSkM1) и бета-1. Cardiovasc Res 42: 503–509.
  39. 39. Makielski JC, Limberis JT, Chang SY, Fan Z, Kyle JW (1996) Совместная экспрессия бета-1 с альфа-субъединицами сердечного натриевого канала в ооцитах снижает блокад лидокаина.Мол Pharmacol 49: 30–39.
  40. 40. Lenkowski PW, Shah BS, Dinn AE, Lee K, Patel MK (2003) Лидокаиновый блок неонатального Nav1.3 дифференцированно модулируется совместной экспрессией субъединиц бета1 и бета3. Eur J Pharmacol 467: 23–30.
  41. 41. Song W, Silver KS, Du Y, Liu Z, Dong K (2011) Анализ действия лидокаина на натриевые каналы насекомых. Насекомое Biochem Mol Biol 41: 36–41.
  42. 42. Silver KS, Nomura Y, Salgado VL, Dong K (2009) Роль шестого трансмембранного сегмента домена IV натриевого канала тараканов в действии инсектицидов, блокирующих натриевые каналы.Нейротоксикология 30: 613–621.
  43. 43. Meacham CA, Brodfuehrer PD, Watkins JA, Shafer TJ (2008) Субъединицы натриевых каналов, регулируемые развитием, по-разному чувствительны к альфа-циано-содержащим пиретроидам. Toxicol Appl Pharmacol 231: 273–281.
  44. 44. Tan J, Choi JS, Soderlund DM (2011) Коэкспрессия с вспомогательными бета-субъединицами модулирует действие тефлутрина на натриевые каналы Na (v) 1,6 и Na (v) 1,3 крысы. Pestic Biochem Physiol 101: 256–264.

Роль интеркалированной клетки Nedd4–2 в регуляции АД, транспорте ионов и экспрессии переносчика

Резюме

Предпосылки Nedd4–2 представляет собой убиквитин-протеин-лигазу E3, которая связывается с транспортными белками, вызывая их убиквитилирование и затем интернализация и деградация.Предыдущее исследование показало корреляцию между Nedd4–2 и BP. В этом исследовании мы исследовали влияние удаления гена интеркалированных клеток (IC) Nedd4–2 на численность и функцию переносчиков IC, а также на АД.

Методы Мы генерировали мышей с нокаутом IC Nedd4–2 , используя технологию Cre-lox, и производили мышей с нулевым геном pendrin / Nedd4–2 , скрещивая глобальные Nedd4–2 null ( Nedd4–2 — / — ) мышей с глобальным отсутствием пендрина ( Slc26a4 — / — ).Мыши питались 1–4% NaCl; АД измеряли с помощью хвостовой манжеты и радиотелеметрии. Мы измерили трансэпителиальный транспорт Cl и общий CO 2 и трансэпителиальное напряжение в корковых собирательных протоках, перфузированных in vitro . Обилие переносчиков определяли с помощью иммуноблотов, иммуногистохимии и цитохимии иммунного золота.

Результаты IC Nedd4–2 удаление гена заметно увеличило электронейтральный обмен Cl / HCO 3 в кортикальном собирательном канале, хотя поток ионов, чувствительных к бензамилу, тиазидам и бафиломицину, сильно изменился. маленький.IC Удаление гена Nedd4–2 не увеличивало количество переносчиков IC типа B, таких как AE4 ( Slc4a9 ), H + -АТФаза, барттин или Na + -зависимый Cl / HCO 3 — теплообменник ( Slc4a8 ). Однако удаление гена IC Nedd4-2 увеличивало содержание общего белка CIC-5, содержание пендрина апикальной плазматической мембраны и отношение экспрессии пендрина на апикальной мембране к цитоплазме. Удаление гена IC Nedd4–2 увеличивало АД примерно на 10 мм рт.Более того, удаление гена пендрина устраняет увеличение АД, наблюдаемое у мышей с глобальным нокаутом Nedd4–2 .

Выводы IC Nedd4–2 регулирует обмен Cl / HCO 3 в ICs., Удаление гена Nedd4–2 увеличивает АД частично за счет его действия в этих клетках.

У людей и грызунов с моделями солеочувствительной гипертензии для повышения АД требуется повышенное потребление Na + и Cl . 1,2 Одна из широко используемых моделей гипертонии человека, чувствительной к соли, на грызунах достигается путем введения альдостерона и диеты с высоким содержанием NaCl. Эта модель лечения вызывает солевочувствительную гипертензию частично за счет стимуляции почечных транспортеров Na + и Cl , таких как эпителиальный канал Na + (ENaC), 3 , тиазид-чувствительный котранспортер NaCl, 4 и пендрин. 5 Альдостерон модулирует абсорбцию NaCl, по крайней мере, в некоторых типах почечных клеток, изменяя количество функциональных транспортеров в клеточной мембране, частично за счет механизма, в котором участвует нейрональная клетка-предшественник убиквитин-протеин-лигаза E3 , экспрессия которой подавляется в процессе развития 4–2 ( Nedd4–2 ). 6–9 Когда переносчик или канал связывается с Nedd4–2 , он убиквитилирован, а затем эндоцитозируется и разрушается в протеасомах или лизосомах. 9,10,11 И наоборот, в отсутствие Nedd4–2 (, т.е. , у Nedd4–2 мышей с нокаутом) интернализация и деградация каналов снижаются, что увеличивает обилие каналов плазматической мембраны, таких как ENaC, тем самым внося свой вклад в чувствительную к соли гипертензию, наблюдаемую у глобальных мышей Nedd4-2 нулевых. 8 Таким образом, повышенное АД наблюдается у мышей с эмбриональным глобальным удалением гена Nedd4–2 8 ; мыши с индуцибельной, специфичной для почек Nedd4–2 , удаление гена 12 ; и люди с определенными полиморфизмами NEDD4-L , человеческого гомолога грызунов Nedd4–2 . 13,14

Транспортеры Na + и Cl , экспрессируемые в основных клетках, и различные подтипы интеркалированных клеток (IC) показаны на Рисунке 1.В кортикальном собирательном канале (CCD) Na + абсорбируется в основном основными клетками, тогда как Cl абсорбируется в основном через IC, 15 в основном за счет электронейтрального обмена Cl / HCO 3 . через микросхемы типа B. 16 Апикальный анионный обмен происходит через апикальный Na + -независимый обмен Cl / HCO 3 , опосредованный главным образом пендрином ( Slc26a4 ), 17,18 , который действует параллельно с Na + -зависимый Cl / HCO 3 обменник, NDCBE, кодируется Slc4a8 19 .Эквиваленты NaCl и чистого H + выходят через базолатеральную плазматическую мембрану IC типа B через канал Cl (ClC-K2 / барттин или ClC-Kb), 20,21 и котранспортер NaHCO 3 (AE4) , 22 и насос H + (H + -ATPase) 22 . Этот выход NaCl и H + увеличивает электрохимический градиент апикального анионного обмена, тем самым увеличивая абсорбцию Cl и секрецию HCO 3 .В отличие от IC типа B, IC типа A опосредуют чистую секрецию HCl в просветную жидкость 23–26 последовательно с захватом Cl и выходом HCO 3 через базолатеральную мембрану через Cl / HCO 3 обмен (AE1), Na + -K + -2Cl котранспортер 1 и канал Cl (рисунок 1). 20,21,26,27

Рис. 1.

Переносчики ионов в кортикальном собирательном канале мышей.Кортикальный собирательный проток мышей состоит из основных клеток, которые обеспечивают электрогенное поглощение Na + через бензамил-чувствительный эпителиальный канал Na + (ENaC) на апикальной плазматической мембране. Na + выходит из основных клеток через базолатеральную плазматическую мембрану через Na, K-АТФазу. Опосредованное ENaC поглощение Na + создает отрицательное напряжение в просвете, которое обеспечивает движущую силу для секреции K + . ИС типа B опосредуют электронейтральную абсорбцию NaCl и секрецию HCO 3 через апикальную плазматическую мембрану Na + -независимый электронейтральный Cl / HCO 3 обменник (пендрин), который действует в тандеме с Na + -зависимый Cl / HCO 3 обменник.NaCl выходит из клетки через канал базолатеральной плазматической мембраны Cl и котранспортер NaHCO 3 (AE4). Чистые эквиваленты H + выходят через базолатеральную плазматическую мембрану через H + -АТФазу. IC типа A опосредует захват эквивалентов H + и Cl через базолатеральную плазматическую мембрану через Na + -K + -2Cl котранспортер 1 (NKCC1), Cl / HCO 3 — обмен (AE1) и, возможно, канал Cl .Этот тип клеток секретирует HCl через апикальную H + -АТФазу и апикальный канал Cl или обменник Cl / HCO 3 .

Nedd4–2 экспрессируется в чувствительной к альдостерону области нефрона, 10 , которая включает соединительный каналец (CNT), CCD и OMCD. Мышиные CNT состоят из клеток CNT и IC, тогда как CCD мыши состоят из основных клеток и IC. 28 Nedd4–2 сильно экспрессируется в ПЗС и УНТ, 10 особенно в ИС типа B и не-A, не-B; Клетки УНТ; и основные клетки, с гораздо меньшим содержанием в ИС типа А. 10 Хотя роль Nedd4-2 в основных клетках хорошо изучена, мало что известно о его функции в ICs. Наша способность генерировать мышей, у которых Nedd4–2 исчезновение гена произошло конкретно в пределах IC ПЗС плюс наша способность перфузировать ПЗС in vitro от этих мышей 29 предоставляют уникальную возможность для изучения физиологической роли IC Nedd4–2 в нативной ткани.

Механизм передачи сигнала альдостерона в ИС типа B плохо изучен.Поскольку Nedd4-2 участвует в передаче сигналов альдостерона во многих типах клеток и поскольку Nedd4-2 экспрессируется в ICs, мы попытались определить, изменяет ли Nedd4-2 АД, изменяя функцию IC. Цель этого исследования состояла в том, чтобы определить, изменяет ли удаление гена IC Nedd4–2 ионный транспорт CCD или BP, и определить транспортер (ы), регулируемый Nedd4–2 внутри ICs.

Результаты

IC Nedd4–2 сокращается в B1 H

+ -ATPase Cre; Nedd4–2 loxloxcre Мыши

Чтобы изучить влияние Nedd4–2 на функцию IC, мы сгенерировали нулевых мышей IC Nedd4–2 с использованием технологии Cre-lox (B1-ATPase Cre; Nedd4–2 loxloxcre ).Чтобы определить, ограничен ли нокдаун Nedd4–2 ICs, мы исследовали локализацию Cre-рекомбиназы у этих мышей, скрещивая их с мышами-репортерами Cre (мыши tdTomato) и изучая их потомство. В клетках, экспрессирующих рекомбиназу Cre, стоп-кодон удаляется, что приводит к экспрессии tdTomato, который флуоресцирует красным. 31 IC были идентифицированы с помощью комбинированного мечения AE1 и пендрина. 32 На рис. 2A показана экспрессия dTomato (Cre-рекомбиназа) (красный цвет) в большинстве пендрин / AE1-положительных клеток (IC) (рис. 2A, зеленый) CCD, с только случайной экспрессией в пендрин / AE1-отрицательных клетках ( основные ячейки).В CNT мечение dTomato также наблюдалось в большинстве пендрин / AE1-положительных клеток (ICs), хотя около 50% пендрин / AE1-отрицательных клеток (CNT-клетки) имели слабое мечение dTomato, что согласуется с предыдущими сообщениями. 30,33 Мечение dTomato также наблюдалось в отдельных клубочках, иногда в кровеносных сосудах и некоторых клетках интерстиция (рис. 2, B и C).

Рис. 2. Рекомбиназа

Cre экспрессируется в основном внутри IC мышей с нокаутом IC Nedd4–2 .Чтобы определить, ограничена ли экспрессия Cre-рекомбиназы IC, IC Nedd4-2 нулевых мышей скрещивали с мышами-репортерами Cre (tdTomato). Полученное потомство B1-АТФазы Cre (+), dTomato (±) исследовали после 7 дней желированной диеты (1,4 мэкв / д NaCl). Иммунофлуоресценция dTomato (красный) отражает экспрессию рекомбиназы Cre в этой клетке. На панели A показаны IC, идентифицированные комбинированным пендрином и маркировкой AE1 (зеленый) в репрезентативном кортикальном собирательном канале (CCD) и соединительном канальце (CNT). Базолатеральная зеленая иммунофлуоресценция (белые стрелки) указывает на базолатеральную экспрессию AE1, маркер IC типа A, тогда как маркировка апикальной зеленой флуоресценции (белые стрелки) указывает на экспрессию пендрина, маркер типа B и не-A, не-B IC.(A, верхняя панель) В CCD зеленая флуоресценция и красная флуоресценция наблюдаются в одних и тех же клетках, что указывает на то, что экспрессия рекомбиназы Cre ограничена IC. (A, нижняя панель) В УНТ редкие AE1 / пендрин-отрицательные клетки (клетки CNT) экспрессируют сильную рекомбиназу dTomato / Cre (открытые стрелки), хотя большинство клеток CNT либо не имеют флуоресценции dTomato (звездочки), либо имеют слабую dФлуоресценция помидоров (пустые стрелки). Мы также наблюдали случайную флуоресценцию dTomato вне собирательного канала и УНТ.Хотя не все типы клеток можно было идентифицировать на этих изображениях, dTomato иногда наблюдался (B) в клубочках, (B) в кровеносных сосудах и в некоторых клетках (C) в интерстиции.

Для дальнейшей оценки специфичности удаления гена IC Nedd4–2 мы исследовали мечение Nedd4–2 (рис. 3, коричневый) в ПЗС, взятых у нокаутов IC Nedd4–2 и однопометников дикого типа. Маркировка AQP2 (рис. 3, темно-синий) идентифицировала основные клетки. Распределение Nedd4–2 -положительных и -отрицательных клеток было количественно определено в CCD от мышей в каждой группе (таблица 1).Как показано, почти все AQP2-положительные клетки (основные клетки) помечены как Nedd4–2 , независимо от того, были ли они взяты из IC Nedd4–2 null или их однопометников дикого типа ( Nedd4–2 loxlox ). Nedd4-2 Метка отсутствовала в 28% IC от CCD дикого типа, что согласуется с предыдущими сообщениями, показывающими слабую экспрессию Nedd4-2 в ICs типа A мыши. 10 Однако иммунная метка Nedd4–2 отсутствовала в 72% ИК от ИК Nedd4–2 нулевых ПЗС.Поскольку эти эксперименты показывают значительный нокдаун Nedd4–2 в ИС ПЗС от IC Nedd4–2 нулевых мышей с небольшим нокдауном в основных клетках, и поскольку ПЗС мыши можно перфузировать in vitro , это исследование было сосредоточено в первую очередь на эффекте IC Удаление гена Nedd4–2 при переносе ионов в CCD мыши.

Рисунок 3.

Nedd4–2 -мечение снижено в ICs, взятых из кортикальных собирательных каналов мышей с нокаутом IC Nedd4–2 .На этом слайде показаны корковые срезы мышей с нокаутом Nedd4–2 и однопометника дикого типа, помеченные для AQP2 (синий; основной маркер клетки) и Nedd4–2 (коричневый). Звездочками отмечены AQP2-положительные (основные) клетки, а стрелками показаны AQP2-отрицательные (IC) клетки. В корковых срезах мышей дикого типа Nedd4-2 метка наблюдалась как в ICs, так и в основных клетках. Однако у IC Nedd4-2 нулевых мышей, тогда как Nedd4-2 метка наблюдалась в основных клетках, Nedd4-2 метка наблюдалась только в редких IC (AQP2-отрицательные клетки).

Таблица 1.

Nedd4–2 иммунная метка в типах клеток кортикального собирательного протока мыши, взятых у Cre (+), IC Nedd4–2 null и Cre (-), однопометников дикого типа после 7 дней NaCl- богатая диета (1,4 мЭкв / сут NaCl)

Удаление гена Nedd4–2 в основных клетках увеличивает содержание ENaC апикальной плазматической мембраны, что стимулирует абсорбцию Na + , тем самым увеличивая трансэпителиальное напряжение с отрицательным просветом (рис. 1). 8 При увеличении абсорбции Na + , опосредованной ENaC, большее падение люмен-отрицательного V T наблюдается при применении ингибиторов ENaC, таких как бензамил, что, таким образом, увеличивает трансэпителиальное напряжение, чувствительное к бензамилу, V Т .Чтобы определить, произошло ли удаление гена Nedd4–2 в основных клетках, мы сравнили активность ENaC в CCD от глобальных мышей Nedd4–2 null и IC Nedd4–2 нулевых мышей и их контрольных животных дикого типа путем измерения чувствительности к бензамилу. V T в ПЗС от мышей в каждой группе. На рис. 4 показана значительная бензамил-чувствительная V T в CCD от мышей с глобальным нокаутом Nedd4–2 , у которых произошло удаление гена Nedd4–2 как в IC, так и в основных клетках. 8 Напротив, бензамил-чувствительный V T был низким в ПЗС IC Nedd4–2 нулевых, и он существенно не отличался от измеренного у их однопометников дикого типа (Рисунок 4). Эти данные показывают небольшое увеличение активности ENaC в основных клетках CCD от мышей с нокаутом IC Nedd4–2 , что согласуется с минимальным нокдауном Nedd4–2 в этом типе клеток.

Рисунок 4.

Глобальная, но не интеркалированная клетка (IC) — специфическая Nedd4–2 Удаление гена увеличивает чувствительность к бензамилу V T .Бензамил-чувствительный компонент V T был рассчитан и использован в качестве индикатора эпителиального поглощения Na + , опосредованного каналом Na + . Бензамил-чувствительный V T был низким и существенно не отличался в кортикальных собирательных трубках (CCD) от мышей с нокаутом IC Nedd4–2 ( n = 3) и однопометников дикого типа [Cre (-), floxed Nedd4–2 мышей; n = 3; левая панель]. Напротив, бензамил-чувствительный V T был намного выше в ПЗС от глобальных Nedd4–2 нулевых мышей ( n = 3) по сравнению с контролем C57Bl / 6 дикого типа ( n = 4; правая панель) .

IC

Nedd4–2 Удаление гена не меняет электролиты сыворотки, альдостерон или pH артериальной крови

Поскольку переносчики IC часто модулируются изменениями концентрации альдостерона в сыворотке, кислотно-щелочного баланса или сывороточных электролитов, мы исследовали каждый из них. у мышей с нокаутом IC Nedd4–2 и однопометников дикого типа. Таблица 2 показывает, что электролиты сыворотки и газы артериальной крови одинаковы у мышей обеих групп. Поскольку альдостерон в сыворотке такой же или ниже в IC Nedd4–2 null по сравнению с однопометниками дикого типа, если удаление гена Nedd4–2 увеличивает численность или функцию переносчика IC, это не происходит из-за увеличения циркуляции крови. альдостерон.

Таблица 2.

Влияние интеркалированной клетки Nedd4–2 удаление гена на сывороточные электролиты, газы артериальной крови и сывороточный альдостерон

IC

Nedd4–2 Удаление гена увеличивает электронейтральный Cl / HCO 3 — Обмен в CCD мыши

Поскольку ICs опосредуют транспорт Cl и HCO 3 , мы исследовали влияние удаления гена IC Nedd4–2 на трансэпителиальный Cl и HCO 3 транспорт.На рис. 5А показаны секреция Cl и абсорбция HCO 3 в CCD, взятых от мышей дикого типа, потребляющих диету с высоким содержанием NaCl, аналогично нашим предыдущим наблюдениям. 23,34 Напротив, CCD от IC Nedd4–2 нулевых мышей поглощают, а не секретируют, Cl и секретируют, а не поглощают, HCO 3 . Трансэпителиальное напряжение было низким и статистически не отличалось в CCD от мышей с нокаутом IC Nedd4–2 и их однопометников дикого типа (рис. 5A).Следовательно, удаление гена IC Nedd4–2 увеличивает электронейтральный обмен Cl / HCO 3 в CCD мыши.

Рисунок 5.

Интеркалированная клетка (IC) Nedd4–2 удаление гена увеличивает электронейтральный обмен Cl / HCO 3 . (A) Поток Cl (J Cl ) и tCO2 (J tCO2 ), а также трансэпителиальное напряжение, V T , были измерены в IC Nedd4–2 мышей с нокаутом и Cre (-) , floxed Nedd4–2 однопометники (однопометники дикого типа).Как показано, кортикальные собирательные каналы (CCD) однопометников дикого типа секретируют Cl ( n = 4) и поглощают tCO 2 ( n = 5). Напротив, CCD от IC Nedd4–2 нулевых мышей поглощают Cl ( n = 4) и секретируют tCO 2 ( n = 4). V T , однако, не изменился при удалении гена IC Nedd4–2 ( n = 8 мышей дикого типа и n = 8 IC Nedd4–2 нулевых мышей). B показывает, что удаление гена Nedd4-2 как в основных клетках, так и в IC ( n = 3) также увеличивало абсорбцию Cl , J Cl по сравнению с таковой в контроле дикого типа (C57Bl / 6; n = 4).Трансэпителиальное напряжение, В T , составляло -2,2 ± 0,84 мВ ( n = 4) у мышей C57 Bl / 6, дикого типа и -10,3 ± 4,0 мВ ( n = 3) в глобальном масштабе Nedd4–2. нулевых мышей.

ENaC представляет собой регулируемый Nedd4–2 канал, который обеспечивает движущую силу для чувствительного к бензамилу поглощения Cl в CCD мыши, которое может происходить через параклеточный транспорт Cl . 23,27 Таким образом, мы спросили, выше ли абсорбция Cl в ПЗС от глобальных Nedd4–2 нулевых мышей, у которых Nedd4–2 устранение гена произошло как в основных клетках, так и в IC, чем в IC . Nedd4–2 мышей с нокаутом, у которых удаление гена Nedd4–2 было ограничено ICs.Рисунок 5B показывает, однако, что глобальная делеция Nedd4-2 приводила к изменениям потока Cl , которые были численно и направленно аналогичны тем, которые наблюдались у IC Nedd4-2 нулевых мышей. Мы пришли к выводу, что изменение транспорта CCD Cl , которое следует за глобальным удалением гена Nedd4–2 , является преимущественно трансклеточным через ICs.

IC

Nedd4–2 Удаление гена дает только небольшой прирост чистого потока H + , J tCO2 , что является чувствительным к ингибиторам H + -АТФазы

Хотя пендрин опосредует обмен 1: 1 Cl и HCO 3 , 35 IC Удаление гена Nedd4–2 увеличило поглощение Cl больше, чем секреция HCO 3 .Поэтому мы спросили, увеличивает ли удаление гена IC Nedd4–2 количество и функцию апикальной H + -АТФазы, тем самым ослабляя прирост концентрации HCO в просвете 3 , генерируемый с увеличением апикального Cl / HCO 3 обмен. Если это так, то ингибирование секреции H + с помощью IC типа A должно увеличивать секрецию HCO 3 у CCD мышей с нокаутом IC Nedd4–2 , чем у мышей из их однопометников дикого типа.Чтобы ответить на этот вопрос, мы измерили J tCO2 до и после нанесения ингибитора H + -АТФазы (бафиломицина) на люминальную жидкость. Дополнительная фигура 1A показывает, что апикальная блокада H + -АТФазы вызывала небольшое увеличение секреции tCO2 у мышей с нокаутом IC Nedd4-2 , но не у однопометников дикого типа. Однако изобилие H + -АТФазы и субклеточное распределение в IC типа A были сходными в почках IC Nedd4–2 нулевых мышей и однопометников дикого типа (дополнительная фигура 1B, дополнительная таблица 1).Мы пришли к выводу, что хотя удаление гена Nedd4–2 увеличивает секрецию H + с помощью ICs типа A, это изменение невелико и не сопровождается увеличением содержания белка H + -ATPase в апикальной области. Отсутствие значительного эффекта удаления гена Nedd4–2 на численность и функцию H + -АТФазы в IC типа A объясняется либо низкой экспрессией Nedd4-2 в IC типа A, либо тем, что апикальный H + -АТФаза существенно не модулируется Nedd4–2 .

IC

Nedd4–2 Абляция гена вызывает небольшое изменение либо тиазид-, либо бензамил-чувствительного поглощения Cl и не увеличивает Na + -зависимый Cl / HCO 3 обменник ( Slc4a8 ) Изобилие

В ПЗС грызунов абсорбция Cl происходит через механизмы, чувствительные к тиазидам и амилоридам (бензамил). 36 Первое происходит посредством электронейтральной абсорбции NaCl, которая включает Na + -зависимый обменник Cl / HCO 3 , NDCBE, кодируемый Slc4a8 , 19 , тогда как последний происходит через электрогенный механизм, управляемый отрицательным в просвете напряжением, генерируемым ENaC-опосредованным поглощением Na + . 23

Чтобы определить, увеличивает ли удаление гена IC Nedd4–2 NDCBE-опосредованное поглощение Cl , мы сравнили чувствительное к тиазиду поглощение Cl в ПЗС от IC Nedd4–2 нулевых мышей и диких мышей. типа однопометники. На рис. 6А показано, что абсорбция Cl несколько снизилась при применении гидрохлоротиазида к перфузату в ПЗС от нулевых мышей IC Nedd4–2 , но не от однопометников дикого типа, что позволяет предположить, что удаление гена IC Nedd4–2 стимулирует Поглощение NaCl, опосредованное NDCBE.Однако, хотя абсорбция Cl была примерно на 23 пмоль / мм в минуту у ПЗС мышей с нокаутом IC Nedd4–2 , чем у однопометников дикого типа, поглощение тиазид-чувствительного Cl увеличивалось только примерно на 1,5 пмоль / мм. в минуту (Рисунок 6B). Таким образом, прирост поглощения тиазид-чувствительного Cl , наблюдаемый при удалении гена IC Nedd4–2 , относительно невелик.

Рисунок 6.

Тиазид-чувствительный J Cl и тиазид-чувствительный Na + -зависимый Cl / HCO 3 обменник (NDCBE; Slc4a8 ) не увеличивается заметно с интеркалированной клеткой (IC) Удаление гена Nedd4–2 .(A) Поглощение Cl , J Cl , измеряли в кортикальных собирательных трубках (CCD) от IC Nedd4–2 нулевых мышей ( n = 13) и однопометников дикого типа (WT) ( n. = 8) с добавлением к перфузату 100 мкг M гидрохлоротиазида (HCTZ) или носителя (Veh). Сплошными линиями показаны эксперименты, в которых Veh присутствовал в первом периоде, а HCTZ был добавлен во втором периоде. Пунктирные линии показывают обратный порядок (, то есть , HCTZ присутствует в периоде 1, а затем удален в периоде 2).B сравнивает чувствительный к тиазиду J Cl в ПЗС обеих групп. C показывает содержание белка NDCBE в обогащенных плазматической мембраной препаратах коры почек IC Nedd4–2 нулевых мышей и однопометников WT. Каждая дорожка была загружена образцом белка от разных мышей; (D) 15 мкл г белков загружали на гелевую дорожку, и равную загрузку подтверждали параллельными гелями, окрашенными Кумасси. Антитело против NDCBE распознало полосу 130 кДа. Денситометрические значения были нормализованы к среднему для однопометников Cre (-), WT.

Поскольку удаление гена IC Nedd4–2 приводило к небольшому увеличению чувствительного к тиазиду компонента поглощения Cl , дальнейшие эксперименты изучали влияние удаления гена IC Nedd4–2 на NDCBE ( Slc4a8 ) в целом. изобилие белка в лизатах почек от нулевых мышей IC Nedd4–2 и однопометников дикого типа. На фигуре 6С показано, что интенсивность полосы NDCBE не была выше в лизатах почек от мышей IC Nedd4-2 нулевых, чем у мышей дикого типа.Мы не смогли изучить влияние удаления гена IC Nedd4–2 на субклеточное распределение NDCBE из-за отсутствия антитела, подходящего для иммуногистохимии или цитохимии иммунного золота. Мы пришли к выводу, что удаление гена IC Nedd4–2 не вызывает заметных изменений в изобилии или функции NDCBE.

В дополнительных экспериментах изучалось влияние абляции гена IC Nedd4–2 на чувствительный к бензамилу компонент поглощения Cl , J Cl (рис. 7).Как показано, бензамил-чувствительный J Cl был подобен в ПЗС от Cre (+), IC Nedd4–2 мышей и Cre (-), однопометников дикого типа. Мы пришли к выводу, что бензамил-чувствительный компонент J Cl не подвержен абляции гена IC Nedd4–2 .

Рисунок 7.

Интеркалированная клетка (IC) Nedd4–2 Удаление гена не увеличивает бензамил (Benz) -чувствительный компонент J Cl . (A) Поглощение Cl , J Cl , измеряли в кортикальных собирательных трубках (ПЗС) у нулевых мышей IC Nedd4–2 ( n = 15) и однопометников дикого типа ( n = 11). ) с 3 μ M Benz или носителем (Veh) в перфузате.Сплошными линиями показаны эксперименты, в которых Вех присутствовал в первом периоде, а Бенц был добавлен во втором. Пунктирные линии показывают обратный порядок (, то есть , Benz присутствует в периоде 1, а затем удаляется в периоде 2). B сравнивает Benz-чувствительный J Cl в ПЗС от мышей в каждой группе. КО, нокаут.

Nedd4–2 Удаление гена увеличивает изобилие ClC-5 в IC типа B, но не в ICs типа A

Поскольку удаление гена ClC-5 может модулировать абсорбцию Cl в CCD мышей, получавших альдостерон, 23 we использовали количественную иммуногистохимию для изучения влияния глобального удаления гена Nedd4–2 на численность и субклеточное распределение ClC-5.Суммарная метка ClC-5 и метка ClC-5 в наиболее апикальных 20% клеток были количественно определены в IC типа A и типа B из CCD глобальных мышей Nedd4–2 с нулевым значением и однопометных однопометников дикого типа. На рисунке 8A показана метка ClC-5 в ИС AE1 (+) типа A и AE1 (-) типа B. На рис. 8, B и C показано, что в IC типа A интенсивность метки ClC-5 на клетку, а также интенсивность метки ClC-5 в наиболее апикальных 20% клеток были одинаковыми у мышей IC Nedd4–2 с нулевым значением и однопометники дикого типа. В IC типа B, однако, общая метка на клетку и метка в самых апикальных 20% клеток были выше у мышей IC Nedd4–2 с нулевым уровнем (рис. 8, D и E).Мы пришли к выводу, что, хотя Nedd4–2 не изменяет содержание ClC-5 или субклеточное распределение в IC типа A, удаление гена Nedd4–2 увеличивает общее содержание белка ClC-5 и относительное содержание ClC-5 в регионе. апикальной плазматической мембраны ВС типа B.

Рисунок 8.

Nedd4–2 удаление гена увеличивает общую метку ClC-5 в интеркалированных клетках (IC) типа B и увеличивает его относительную метку в области апикальной плазматической мембраны. A показано мечение ClC-5 и AE1 в почечных корковых срезах мышей дикого типа и глобального нулевого однопометника Nedd4–2 .В других не показанных экспериментах кортикальные срезы были помечены на ClC-5 и пендрин. Обилие ClC-5 определяли количественно как в ИС типа A (положительный AE1, отрицательный по пендрину; белые стрелки), так и в ИС типа B (отрицательный AE1, положительный по пендрину; черные стрелки). B и C показывают, что удаление гена Nedd4-2 не увеличивало ни общее содержание ClC-5 на клетку, ни метку ClC-5 в области апикальной мембраны ICs типа A. (D и E) Однако в ICs типа B глобальная абляция гена Nedd4-2 увеличивает как количество ClC-5 на клетку, так и относительное количество ClC-5 в области апикальной мембраны.

IC

Nedd4–2 Удаление гена увеличивает количество пендрина в апикальной области плазматической мембраны

Поскольку удаление гена IC Nedd4–2 увеличивает апикальный анионный обмен и поскольку электронейтральный апикальный анионный обмен в CCD в значительной степени зависит от пендрина, дальнейшие эксперименты исследовали влияние удаления гена Nedd4–2 на общее содержание пендринового белка и апикальной плазматической мембраны и субклеточное распределение пендрина. Мы наблюдали, что иммунная метка пендрина несколько более выражена в срезах почек мышей IC Nedd4–2 нулевых, чем у мышей из однопометников дикого типа (рис. 9, A – F).На рис. 9, G – I показано, что удаление гена IC Nedd4–2 либо не дало никаких изменений, либо немного увеличивало содержание общего белка пендрина. Напротив, фиг. 9J показывает, что мРНК пендрина либо не изменилась, либо уменьшилась при удалении гена IC Nedd4–2 .

Рис. 9. Содержание белка пендрина

существенно не изменяется при удалении гена интеркалированных клеток (IC) Nedd4–2 . Кортикальные срезы репрезентативной мыши с нокаутом по IC Nedd4–2 и однопометника дикого типа (WT) были помечены на пендрин.A и D показывают маркировку пендрина при малом увеличении. На вставках показаны типичные (B и E) соединительные канальцы (CNT) и типичные (C и F) кортикальные собирательные каналы (CCD) при большем увеличении. G показывает репрезентативный иммуноблот лизатов почек от мышей с нокаутом IC Nedd4–2 и однопометников WT, исследованных на пендрин и соответствующий гель кумасси синего, что (H) подтверждает загрузку белка. I показано, что плотность полос пендрина сходна в лизатах почек от IC Nedd4–2 нулевых мышей и однопометников WT.J показывает, что мРНК почечного пендрина ( Slc26a4 ), нормализованная до мРНК 18S, является такой же или уменьшается при удалении гена IC Nedd4–2 .

Дальнейшие эксперименты изучали влияние удаления гена IC Nedd4–2 на апикальную плазматическую мембрану и количество пендринов в цитоплазме. Цитохимия иммунного золота с морфометрическим анализом использовалась для количественной оценки общего содержания белка пендрина и субклеточного распределения пендрина как в IC типа B, так и в клетках IC не-A, не-B мышей из каждой группы.На дополнительном рисунке 2 показана золотая метка пендрина в типичном IC типа B, взятом как у нулевой мыши IC Nedd4–2 , так и у однопометника дикого типа. В таблице 3 показаны апикальные плазматические мембраны и золото пендрина цитоплазмы как в типах B, так и в не-A, не-B IC от IC Nedd4–2 нулевых мышей и однопометников дикого типа. Как показано, иммунозолото пендрина апикальной плазматической мембраны по типу B IC было таким же или немного выше у мышей с нокаутом IC Nedd4-2 по сравнению с их однопометниками дикого типа.Однако длина границы апикальной плазматической мембраны IC типа B была на 42% выше, а отношение апикальной плазматической мембраны к содержанию пендрина в цитоплазме было более чем в два раза выше у нулевых мышей IC Nedd4–2 по сравнению с их однопометниками дикого типа.

Таблица 3.

Влияние удаления гена IC Nedd4–2 на апикальную плазматическую мембрану и содержание пендрина в цитоплазме в кортикальном собирательном канальце и соединительном канальце мышей

В не-A, не-B ICs, преобладающем пендрин-положительном типе клеток в CNT, удаление гена IC Nedd4-2 увеличивало длину границы апикальной плазматической мембраны на 48% и увеличивало пендринную (золотую) метку апикальной плазматической мембраны на клетку на 80% (Table 3).Однако различия в соотношении пендриновой (золотой) метки на апикальной плазматической мембране относительно субапикальных пузырьков в этом типе клеток не достигли статистической значимости. Эти данные показывают, что удаление гена IC Nedd4-2 увеличивает содержание пендрина апикальной плазматической мембраны в не-A, не-B IC.

IC Nedd4–2 Удаление гена не увеличивает AE4, H

+ -ATPase или изобилие Барттина

Nedd4–2 Удаление гена может увеличить апикальный Cl / HCO 3 обмен за счет взаимодействия с базолатеральным транспортером плазматической мембраны в ИС типа B (Рисунок 1), который увеличивает движущую силу апикального анионного обмена за счет усиления выхода Na + , Cl и H + .Чтобы проверить эту гипотезу, мы исследовали влияние удаления гена IC Nedd4–2 на численность и субклеточное распределение переносчиков IC типа B, которые локализуются на базолатеральной мембране и опосредуют это Na + , Cl или H + выход (рисунок 1). Как показано (дополнительные рисунки 3 и 4), удаление гена IC Nedd4–2 не увеличивало общую интенсивность иммунной метки AE4 или барттина или интенсивность метки в области плазматической мембраны. Более того, используя цитохимию иммунного золота, мы наблюдали, что барттиновая золотая метка базолатеральной плазматической мембраны не увеличивалась в ICs типа B от IC Nedd4-2 нулевых мышей по сравнению с однопометниками дикого типа (не показано).

Поскольку базолатеральная H + -АТФаза обеспечивает движущую силу для апикального анионного обмена, 22 мы исследовали всего α 4 – H + -АТФазную иммунную метку и α 4 – H + -ATPase субклеточное распределение в IC типа B от IC Nedd4–2 нулевых мышей и однопометников дикого типа (дополнительный рисунок 1, дополнительная таблица 1). Никаких различий в содержании или внутриклеточном распределении IC H + -АТФазы типа B не было обнаружено количественным анализом иммунной метки 4-субъединицы H + -ATPase α у мышей из этих двух групп.

Эти данные показывают, что хотя AE4, H + -ATPase и ClC-K2 / barttin все модулируют апикальный анионный обмен в CCD мыши, они, скорее всего, не делают это посредством взаимодействия с Nedd4-2 .

IC

Nedd4–2 Модулирует BP

Чтобы изучить роль Nedd4–2 внутри ICs в регуляции АД, мы исследовали влияние абляции гена IC Nedd4–2 на АД. С помощью манжеты на хвосте мы наблюдали систолическое АД, которое было сходным у мышей с нокаутом IC Nedd4–2 и однопометников дикого типа, соблюдающих стандартную диету для грызунов (1% NaCl) (дополнительный рисунок 5).Однако после 14 дней диеты с 4% NaCl, которая увеличивает экспрессию Nedd4–2 у мышей дикого типа, систолическое АД 10 было выше у мышей с нокаутом IC Nedd4–2 , чем у однопометников дикого типа. . Чтобы подтвердить эти результаты, 24-часовые записи АД были сделаны с помощью радиотелеметрии после того, как мышей в течение 7 дней давали диету с высоким содержанием NaCl (4% NaCl). За 24-часовой период среднее артериальное давление составило 107 ± 1,1 мм рт. Ст. ( n = 4) у мышей IC Nedd4–2 нулевых и 97 ± 0.9 мм рт. Ст. ( n = 5) у однопометников дикого типа ( P <0,05). Следовательно, АД было примерно на 10 мм рт. Ст. У мышей с нокаутом IC Nedd4–2 , чем у однопометников дикого типа. Более того, как в периоды бодрствования (темнота), так и во время сна (свет), АД было выше у мышей с нулевым значением IC Nedd4–2 , чем у мышей дикого типа (фигура 10А).

Рисунок 10.

Интеркалированные клетки (IC) вносят вклад в прирост АД, наблюдаемый при удалении гена 2 Nedd4–2 .A показывает среднее артериальное давление (САД), измеренное радиотелеметрическим методом через 7 дней диеты с 4% NaCl. Как показано, MAP было выше у мышей IC Nedd4–2 нулевых ( n = 4) по сравнению с однопометниками дикого типа ( n = 5) как во время бодрствования (темный период; с 18:00 до 6:00), так и во время бодрствования. периоды сна (световой период; с 6 до 18 часов). B показывает систолическое АД, измеренное с помощью хвостовой манжеты у мышей дикого типа ( Slc26a4 + / + / Nedd4–2 + / + ), пендрин нулевой ( Slc26a4 — / — / Nedd4–2 + / + ) мышей, Nedd4– 2 нулевых ( Slc26a4 + / + / Nedd4–2 — / — ) мышей, а также мышей, которые были как пендрином, так и Nedd4–2 нулевыми ( Slc26a4 — / — / Nedd4–2 — / — ) после употребления диеты с 4% NaCl ad libitum в течение 6 дней.Измерения проводились на пяти мышах из каждой группы. * P <0,05.

Мы наблюдали нокдаун Nedd4–2 в клетках из IC Nedd4–2 нулевых почек, которые не являются IC (рис. 2). Таким образом, мы не можем исключить возможность того, что удаление нецелевого гена Nedd4–2 вносит вклад в увеличение АД, наблюдаемое у мышей IC Nedd4–2 нулевых. В связи с этим мы использовали дополнительный подход для изучения влияния абляции гена IC Nedd4–2 на АД.Удаление гена пендрина не только устраняет зависимый от пендрина обмен Cl / HCO 3 , но также подавляет другие переносчики ионов IC типа B, которые увеличивают движущую силу апикального анионного обмена, такие как H + — АТФаза. 22,37 Мы предположили, что если глобальная абляция гена Nedd4–2 увеличивает АД частично за счет усиления апикального анионного обмена IC, то устранение апикального обмена Cl / HCO 3 с удалением гена пендрина должно снижает АД больше у глобальных мышей с нулевым уровнем Nedd4–2 , чем у мышей дикого типа Nedd4–2 .Чтобы проверить эту гипотезу, мы сравнили АД, измеренное с помощью хвостовой манжеты в Nedd4–2 — / — / Slc26a4 — / — ; Nedd4–2 + / + / Slc26a4 — / — , Nedd4–2 — / — / Slc26a4 + / + и мыши дикого типа через 7 дней после заражения. Диета с 4% NaCl (рис. 10В). Мы наблюдали, что АД повышалось с глобальным удалением гена Nedd4–2 у мышей, несущих пендрин дикого типа ( Slc26a4 + / + ), как сообщалось ранее. 8 Однако, в то время как удаление гена пендрина снижает систолическое АД у глобальных мышей Nedd4–2 нулевых, оно не оказывает заметного влияния на АД у мышей, несущих дикого типа Nedd4–2 . Мы пришли к выводу, что гипертензия, наблюдаемая у глобальных мышей Nedd4-2 нулевых, частично возникает благодаря механизму, который зависит от ICs.

Обсуждение

Хотя человеческий аналог глобальных мышей с нокаутом Nedd4–2 не наблюдался, ряд человеческих однонуклеотидных полиморфизмов NEDD4–2 сильно коррелируют с изменениями АД. 13 Поскольку Nedd4–2 экспрессируется в IC типа B и поскольку функция IC сильно регулируется альдостероном, 5 мы исследовали влияние удаления гена IC Nedd4–2 на функцию IC и то, как IC Nedd4– 2 — влияет на БП. Мы наблюдали, что удаление гена IC Nedd4–2 у мышей увеличивает апикальный обмен Cl / HCO 3 в CCD и что прирост АД, наблюдаемый при глобальном удалении гена Nedd4–2 , составляет часть, зависящая от микросхем.

Предыдущие исследования показали, что ингибитор ENaC, амилорид, устраняет увеличение АД, наблюдаемое при глобальной абляции гена Nedd4–2 . 8 Эти данные могут показаться расходящимися с нашим наблюдением, что удаление гена пендрина также устраняет прирост АД, наблюдаемый у этих мышей с глобальным нокаутом Nedd4–2 . Возможно, что ингибирование ENaC опосредует падение АД, наблюдаемое в обеих моделях. Удаление гена Nedd4–2 стимулирует как апикальный обмен Cl / HCO 3 в ICs, так и опосредованную ENaC абсорбцию Na + в основных клетках, 8 , которые увеличивают абсорбцию NaCl в почках.Напротив, блокада ENaC, индуцированная амилоридом, устраняет опосредованную ENaC абсорбцию Na + в основных клетках, одновременно стимулируя секрецию HCl IC типа A. 23,24 Следовательно, амилорид снижает абсорбцию NaCl и АД. Поскольку удаление гена пендрина снижает опосредованное ENaC поглощение Na + 38 , удаление гена пендрина снижает АД, 39 частично, за счет ингибирования ENaC.

Глобальные мыши с нокаутом Nedd4–2 , которые мы изучали, обладают фенотипом, который, по-видимому, ограничен гипертонией. 8 Однако перинатальная летальность наблюдается у других глобальных мышей Nedd4–2 с нулевым значением 41 , которые были получены с использованием флоксированных мышей Nedd4–2 , у которых сайты lox P были введены в последовательность, фланкирующую экзон 15, тем самым индуцирование сдвига рамки считывания ниже экзона 15. 41 Мы решили не использовать последних мышей Nedd4–2 , подвергнутых флоксированию, из-за трудностей, возникающих при изучении мышей с высокой перинатальной смертностью. 41,42 Тем не менее, эти данные повышают вероятность того, что использованные нами глобальные и / или нулевые мыши IC Nedd4–2 могут иметь только частичную потерю функции Nedd4–2 ( i.е. , гипоморфы) за счет попеременного сращивания. 6,8,12,41,42 Если так, то наблюдаемые нами изменения переноса ионов, зависящие от Nedd4–2 , недооценивают истинное влияние Nedd4–2 на перенос ионов.

Nedd4–2 ассоциируется с β — или γ -субъединицами ENaC 43 в области С-конца субъединицы, имеющей консервативную последовательность, известную как мотив PY. 11,44 Классические мотивы PY, такие как те, что наблюдаются в субъединицах ENaC β или γ , имеют С-концевую последовательность PPPXYXXL, где P — пролин, Y — тирозин, L — лейцин и X — любая аминокислота. 11,44–46 ClCK-2 / барттин представляет собой канал Cl , который несет мотив PPPXYXXL PY на С-конце субъединицы барттина. 47 Этот канал экспрессируется на базолатеральной плазматической мембране как типа A, так и типа B ICs CCD мыши, и он важен для поглощения Cl , наблюдаемого в этом сегменте. 20,21 В частности, субъединица барттина канала необходима для экспрессии канала плазматической мембраны и, следовательно, для опосредованного каналом транспорта Cl , 48 , который может происходить посредством ассоциации Nedd4-2 . 47,48 Когда мотив барттина PY мутируется и затем экспрессируется в гетерологичных системах экспрессии, наблюдается повышенная активность ClCK-2 / барттин-опосредованного канала Cl , возможно, из-за снижения убиквитинилирования каналов, эндоцитоза и деградации, которые может происходить в отсутствие ассоциации barttin- Nedd4-2 . 47,49 Это исследование показало, однако, что в нативных ICs удаление гена Nedd4–2 не увеличивает ни общее содержание барттина, ни содержание барттина в плазматической мембране.Таким образом, взаимодействие Nedd4-2 и барттина in vivo и физиологическое значение этой ассоциации еще предстоит определить.

ClC-5 представляет собой обменник Cl / H + , экспрессируемый в апикальных областях IC. 50–52 Подобно barttin и ENaC, ClC-5 также несет мотив PY с последовательностью PPLPPY на его С-конце. 53 Когда этот мотив PY мутируется и затем экспрессируется в ооцитах Xenopus , ClC-5-опосредованный ток и поверхностная экспрессия увеличиваются, 53 предположительно из-за отсутствия взаимодействия с Nedd4-2 . 54 ClC-5 ассоциирует с Nedd4-2 в гетерологичных системах экспрессии через этот мотив PY, который снижает опосредованный ClC-5 ток. 54 Однако после удаления мотива PY в проксимальном канальце мыши in vivo не наблюдается изменений в субклеточном распределении ClC-5. 55 Таким образом, неясно, регулирует ли эта ассоциация ClC-5– Nedd4–2 численность, субклеточное распределение или активность канала in vivo ClC-5.Это исследование показало, что содержание общего белка ClC-5 увеличивается с удалением гена Nedd4–2 в клетках типа B, но не в клетках типа A. Эти данные согласуются с предыдущими исследованиями, показывающими большую экспрессию Nedd4-2 , наблюдаемую в первом типе клеток, чем во втором типе клеток. 10 Однако физиологическое значение IC ClC-5 еще предстоит определить. Хотя средняя абсорбция Cl была примерно на 25% ниже у CCD от мышей, получавших альдостерон с нулевым ClC-5, чем у однопометников дикого типа, различия не достигли статистической значимости. 23 Таким образом, вносит ли ClC-5 вклад в изменение потока Cl , наблюдаемое при абляции гена Nedd4-2 , и экспрессируется ли он на апикальной плазматической мембране IC, еще предстоит определить. 23

Эти исследования ClCK-2 / барттина и ClC-5 показывают, что взаимодействие Nedd4-2 с его белками-мишенями может различаться в гетерологичных системах экспрессии и в нативных тканях. В культивируемых клетках могут отсутствовать дополнительные белки, которые важны для белковых комплексов, встречающихся в нативной ткани.Более того, сверхэкспрессия белка 56 и флуоресцентные белковые метки 57 могут приводить к неспецифическим, нецелевым эффектам. Таким образом, случайные ассоциации, наблюдаемые в гетерологичных системах экспрессии, не могут быть подтверждены в нативных тканях, 55 оставляя под сомнение физиологическое значение первоначальных наблюдений. Учитывая эти ограничения, мы решили сначала изучить физиологическую роль Nedd4–2 в функции IC, изучив влияние абляции гена Nedd4–2 на функцию транспортера в нативных CCD, а затем используя эти изменения в переносе ионов для прогнозирования конкретных белковые мишени.Затем мы проверили эту гипотезу, исследуя влияние удаления гена IC Nedd4–2 на численность переносчиков IC и субклеточное распределение в нативной ткани мыши.

Это исследование показывает, что увеличение апикального обмена Cl / HCO 3 , наблюдаемое при абляции гена Nedd4–2 , происходит, по крайней мере частично, из-за увеличения количества пендринов апикальной плазматической мембраны. Это увеличение содержания пендрина в апикальной плазматической мембране происходит в основном за счет изменений субклеточного распределения пендрина, а не за счет увеличения содержания общего белка пендрина.Как таковой, Nedd4-2 может представлять собой ступень в каскаде передачи сигналов альдостерона, с помощью которого регулируются обилие пендринового белка, субклеточное распределение и функция.

Хотя пендрин не имеет мотива PY с последовательностью PPXY, он имеет два мотива PY с последовательностями LPXY, которые могут обеспечивать мотивы узнавания для Nedd4–2 WW доменов. Один из них, LPKYR, соответствует аминокислотам 75–79 последовательности пендрина мыши, крысы и человека и аминокислотам 71–75 в Xenopus , обеспечивая потенциальный сайт взаимодействия Nedd4–2 . 58 Однако некоторые белки, такие как тиазид-чувствительный котранспортер NaCl, ассоциируют с Nedd4-2 независимо от мотива PY. 6 Как таковой, IC транспортер, такой как пендрин, может ассоциироваться с Nedd4-2 через или независимо от С-концевого мотива PY.

Ген Nedd4–2 может нацеливаться на другой транспортер IC Cl типа B, не испытанный в этом исследовании. Например, в дополнение к транспортерам IC типа B, показанным на рисунке 1, Slc26a11 выражается в IC и действует либо как обменник Cl / HCO 3 , либо как канал Cl . 59 Модулирует ли Slc26a11 трансэпителиальный ионный транспорт, экспрессируется ли он на плазматической мембране и модулируется ли он Nedd4–2 , еще предстоит определить. Альтернативно, Nedd4-2 может ассоциироваться с рецептором или сигнальной молекулой в ICs типа B, которая изменяет апикальный анионный обмен.

IC Удаление гена Nedd4–2 привело к значительному увеличению абсорбции Cl без статистически значимого изменения трансэпителиального напряжения.Однако мы не можем исключить возможность того, что удаление гена IC Nedd4-2 вызывало небольшое увеличение на 1-2 мВ трансэпителиального напряжения, отрицательного для просвета. Поскольку CCD транспортирует Cl через парацеллюлярный и трансэпителиальный транспорт и поскольку Nedd4–2 усиливает параклеточную проводимость в собирающих клетках протоков, связываясь с окклюдином, удаление гена 60 IC Nedd4–2 может изменить поток Cl . через изменения параклеточного транспорта.Однако для изменения трансэпителиального напряжения до -2 мВ, чтобы вызвать значительное поглощение Cl посредством параклеточного транспорта, должно быть большое падение сопротивления канальцев. Это маловероятно, потому что сверхэкспрессия Nedd4–2 в культивируемых клетках CCD не изменяет резистентность в стабильном состоянии. 60 Более того, если удаление гена IC Nedd4–2 стимулирует опосредованное окклюдином поглощение Cl , оно также должно стимулировать окклюдин у глобальных мышей Nedd4–2 с нулевым уровнем.Поскольку отрицательное напряжение просвета выше в ПЗС от глобальных мышей по сравнению с IC Nedd4–2 нулевых мышей, мы должны увидеть гораздо больший прирост поглощения Cl в ПЗС от глобального по сравнению с IC Nedd4– 2 нулевых мышей. Вместо этого мы наблюдали аналогичное изменение потока Cl в ПЗС от глобальных мышей и нулевых мышей IC Nedd4–2 по сравнению с контрольными мышами дикого типа. Мы пришли к выводу, что удаление гена IC Nedd4–2 изменяет поток Cl в CCD мышей в основном за счет трансцеллюлярного транспорта.

Будущие эксперименты будут изучать, ассоциируются ли Nedd4-2 и пендрин и изменяет ли эта ассоциация убиквитилирование пендрина апикальной плазматической мембраны. 11,43,61 Более того, поскольку Nedd4–2 существует столько же изоформ из-за использования альтернативных промоторов и вариабельного сплайсинга, 62 , изоформы которых опосредуют Nedd4–2--зависимые изменения в транспорте ионов IC, также остаются в силе. определяется.

В заключение, удаление гена IC Nedd4–2 увеличивает электронейтральный обмен Cl / HCO 3 в CCD мышей частично из-за субклеточного перераспределения пендрина, что увеличивает количество его апикальной плазматической мембраны.Прирост BP, наблюдаемый ранее при полном отсутствии Nedd4–2 , частично происходит благодаря IC-зависимому механизму.

цАМФ-зависимая регуляция HCN4 контролирует процесс тонического вовлечения в пейсмекерные клетки синоатриального узла

Заявление об этике

Все исследования на животных были одобрены Regierung von Oberbayern, проводились в соответствии с немецкими законами об экспериментах на животных и выполнялись в соответствии с общепринятыми этическими стандартами.Были предприняты усилия, чтобы свести количество животных к минимуму.

Создание линии мышей HCN4FEA

Используя гомологичную рекомбинацию в ES-клетках, мы создали глобальную модель мыши с ноккином (HCN4FEA), которая экспрессирует каналы HCN4 с двумя аминокислотными заменами в циклическом нуклеотид-связывающем домене (R669E, T670A) и одной заменой. в С-линкере (Y527F, рис. 1д). Целевой локус HCN4 WT включает экзоны 3-8. Мутация C-linker локализована в экзоне 4, а обе мутации циклического нуклеотид-связывающего домена расположены в экзоне 7.

Исследования на животных

Мышей WT и HCN4FEA ( Hcn4 тм3 (Y527F; R669E; T670A) Biel ) были получены путем домашнего разведения и содержались на смешанном фоне C57BL / 6 N и 129 / SvJ. Разведение одного самца и двух самок содержалось в обычных клетках Евростандарта типа III в условиях SPF в условиях 12-часового цикла темнота-свет с пищей и водой ad libitum. Температура окружающей среды 22 ° C, влажность 60%. На стадии P21 потомство было разделено и помещено в группы (2–5 животных в клетке; Евростандарт, тип II, длинный) в одинаковых условиях окружающей среды.Животных содержали в течение 2–6 месяцев, и однопометники того же пола случайным образом распределяли по экспериментальным группам, как указано в соответствующем абзаце в разделе «Подробности метода».

Клеточные линии

HEK293 (эмбриональная почка человека [ Homo sapiens ]) были получены из ATCC [https://www.atcc.org/] и культивированы в среде Игла, модифицированной Дульбекко (DMEM, низкий уровень глюкозы, GlutaMax TM Supplement, пируват) с добавлением 10% фетальной бычьей сыворотки, 100 МЕмл -1 пенициллина, 100 мкг мл -1 стрептомицина и 1,0 мг мл -1 G418. Клетки Flp-In ™ -293 (эмбриональная почка человека [Homo sapiens]) были получены от Thermo Fisher Scientific, а стабильные клеточные линии были созданы с использованием системы Flp-In ™ от Invitrogen (Thermo Fisher Scientific, США). Клетки Flp-In ™ -293 культивировали в среде DMEM (высокое содержание глюкозы, добавка GlutaMax TM , пируват) с добавлением 10% фетальной бычьей сыворотки, 100 МЕ. мл -1 пенициллина, 100 мкг мл -1 стрептомицина и 100 мкг мл -1 гигромицина B.Все клеточные линии инкубировали при 37 ° C с 10% CO 2 .

Выделение РНК, процессинг ChIP и биоинформатический анализ.

РНК из SAN самцов мышей WT и HCN4FEA ( n = 3 каждая) выделяли с использованием набора RNeasy Micro Kit (Qiagen, Нидерланды). Качество образца РНК проверяли на Agilent BioAnalyzer 2100 (Agilent Technologies, Германия) и обрабатывали для получения генетических чипов Affymetrix с использованием набора для маркировки смысловой мишени целого транскрипта Affymetrix (Affymetrix, США).Фрагментированную и меченую кДНК гибридизовали на мышиных генных чипах MouseGene1.1-ST. Окрашивание биотинилированной кДНК и сканирование массивов проводили в соответствии с рекомендациями производителя. Необработанные CEL-файлы были импортированы в Expression Console 1.0. RMA (Affymetrix, США), который использовался для нормализации массива и расчета сигнала. Нормализованные значения сигналов были импортированы в Partek Genomics Suite 6.5. Наборы зондов использовали для расчета дифференциально экспрессируемых транскриптов с использованием теста Велча t с пороговым значением p , равным 0.05 и кратность 1,5. Выделение РНК

и количественная ОТ-ПЦР

РНК

из SAN мышей WT и HCN4FEA в возрасте 3 месяцев ( n = 3 каждая) выделяли с использованием набора RNeasy Micro Kit (Qiagen, Нидерланды). кДНК синтезировали с помощью набора RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, США). ОТ-ПЦР выполняли, как описано ранее 9 , и повторяли три раза.

PyMOL

Рисунок структуры С-конца был подготовлен с использованием PyMOL.Структура основана на последовательности 521-723 структуры HCN4 человека в комплексе с цАМФ 45 , загруженной из базы данных белков (код доступа: 3U11).

Обычная электрофизиология в клетках HEK293

Клетки HEK293, временно экспрессирующие WT HCN4 или мутантные каналы HCN4FEA, использовали для записи. Токи измеряли при комнатной температуре (RT) с использованием метода фиксации напряжения для всей клетки с усилителем Axon 200B и программным обеспечением Clampex 10.5.2.6 и анализировали с помощью Clampfit 10.5.2.6 программное обеспечение. Внеклеточный раствор состоял из 135 мМ NaCl, 5 мМ KCl, 1,8 мМ CaCl 2 , 0,5 мМ MgCl 2 и 5 мМ HEPES (pH доведен до 7,4 с помощью NaOH). Внутриклеточный раствор содержал 130 мМ KCl, 10 мМ NaCl, 0,5 мМ MgCl2, 1 мМ EGTA, 5 мМ HEPES, 3 мМ MgATP и 0,5 мМ NaGTP (pH доведен до 7,4 с помощью КОН). К раствору добавляли 100 мкМ цАМФ и снова устанавливали pH. Кривые активации установившегося состояния определяли по ступеням гиперполяризационного напряжения от -140 до -30 мВ с шагом 10 мВ от удерживающего потенциала -40 мВ в течение 4.5 с (интервал между импульсами 20 с) с последующим шагом до -140 мВ. Чтобы отразить более физиологические условия, кривые активации в установившемся состоянии также были измерены при 30 ° C с более гиперполяризованными удерживающими потенциалами (-55 мВ, -65 мВ, -75 мВ), а ступени напряжения от -140 до 0 мВ применялись в 10 мВ. с шагом 5,0 с (интервал между импульсами 30 с) с последующим шагом до -140 мВ на 0,5 с. Токи, измеренные сразу после последнего шага до -140 мВ, были нормированы на максимальный ток ( I макс ) и нанесены на график как функция предыдущего мембранного потенциала.Точки данных были подогнаны с помощью функции Больцмана: ( I I мин. ) / ( I макс. I мин. ) = (1 — exp (( V м В 0,5 ) / k )), где I мин — это смещение, вызванное ненулевым током удержания, В м — испытательный потенциал, В 0,5 — мембранный потенциал для полумаксимальной активации, а k — коэффициент наклона.

Для определения кинетики активации и дезактивации, каналы WT HCN4, HCN4F и HCN4FEA, стабильно экспрессируемые в клетках Flip-In ™ -293, измеряли при комнатной температуре с использованием метода фиксации напряжения для всей клетки. Для определения кинетики активации использовали те же растворы, что описаны выше, тогда как для определения кинетики дезактивации концентрацию калия во внеклеточном растворе увеличивали до 30 мМ путем эквимолярной замены NaCl на KCl. Для измерений с добавлением цАМФ к внутриклеточному раствору добавляли 100 мкМ цАМФ и повторно регулировали pH.Кинетику активации и дезактивации определяли после гиперполяризации клетки до -140 мВ в течение 3,75 с от удерживающего потенциала -40 мВ с последующими скачками напряжения обратно от -30 мВ до -60 мВ, приложенных в течение 9 с. Для кинетики активации кривые тока при потенциалах от -140 мВ до -110 мВ и для кинетики дезактивации кривые тока от -30 мВ до -60 мВ после максимальной гиперполяризации были подобраны с помощью одной экспоненциальной функции ( I = I с. + A exp [- t / τ]) после начальной задержки. I ss представляет собой установившийся ток, а τ представляет собой постоянную времени. Вычитался линейный ток утечки.

Сердца, наполненные желатином

Сердца, наполненные желатином, получали, как описано ранее 1 . Мышь анестезировали ингаляцией 5% изофлураном (CP-Pharma, Германия) и умерщвляли смещением шейного отдела позвоночника. Сундук вскрыли и сделали несколько разрезов в печени. Сердце перфузировали через левый желудочек PBS до тех пор, пока оно не освободилось от крови, с последующей перфузией теплым 2% водным раствором желатина.Сразу же на сердце, заполненное желатином, выливали холодный PBS и все тело хранили при 4 ° C в течение 1 часа, чтобы желатин затвердел. Затем сердце осторожно вырезали и переносили в чашку, содержащую холодный PBS, чтобы удалить избыток желатина и ткани. Изображения получали с помощью стереомикроскопа (Stemi 508, Carl Zeiss AG, Германия), оснащенного цветной камерой (AxioCam 512 color, Carl Zeiss AG, Германия) и программой ZenCore 5.3.

Эхокардиография

Эхокардиографические изображения были получены с использованием системы ультразвуковой визуализации грызунов (Vevo 2100, FUJIFILM VisualSonics, Канада) с использованием системы преобразователя 22–55 МГц (MS550D).Перед измерениями самцов мышей подвергали седации путем ингаляции изофлурана (Abbott, Германия). После достижения седативного эффекта животных помещали на системный стол для работы с мышами, чтобы контролировать температуру тела, частоту сердечных сокращений и частоту дыхания. Изображения по длинной оси, M-режим и PW-доплеровские изображения были получены и проанализированы с использованием системного программного обеспечения. Во время экспериментов и анализа исследователи не знали генотипа и экспериментальной группы. Животные были идентифицированы по меткам.

Окрашивание HE

Сердца трехмесячных мышей-самцов WT и HCN4FEA удаляли, фиксировали в 4% параформальдегиде в течение 2 часов и инкубировали в сахарозе при 4 ° C в течение ночи.Затем сердечки погружали в компаунд с оптимальной температурой резания (Tissue Tek, Sakura Finetek, Германия) и разрезали на срезы толщиной 12 мкм с помощью криостата. Срезы окрашивали гематоксилином и эозином по стандартным протоколам.

Иммуногистохимия поперечного сечения SAN и анализ фиброза

Трехмесячных самцов животных умерщвляли и сердца перфузировали PBS, как описано в разделе сердец, наполненных желатином. После перфузии PBS сердца вырезали и препарировали SAN.Ткань фиксировали 4% PFA в PBS в течение 25 минут, промывали PBS и затем инкубировали в течение 2 часов в 25% сахарозе в PBS. SAN заливали в компаунд с оптимальной температурой резки (Tissue Tek, Sakura Finetek, Германия) и разрезали на секции толщиной 4 мкм с помощью криостата. Срезы подвергали проницаемости в течение 1–1,5 ч с помощью 0,5% Triton X-100 в 20% DMSO в PBS. После трехкратной промывки PBS блокирование достигалось 1 ч инкубации в 5% нормальной ослиной сыворотке в PBS. Следующие три стадии промывки сопровождались инкубацией в течение ночи при 4 ° C с антителами морской свинки против HCN4 и кроличьими антителами против HCN1 (1: 200 в PBS, Alomone labs, Израиль).Срезы промывали PBS перед инкубацией со вторичными антителами (FITC-конъюгированные ослиные анти-морские свинки, 1: 100 и Cy3-конъюгированные ослиные антикроличьи, 1: 400, Merck Millipore, Германия) в течение 4 ч при комнатной температуре без исключения. света. Срезы промывали, наносили на монтажную среду (Vectashield, Vector Laboratories, Великобритания) и анализировали с использованием конфокального микроскопа Leica SP8 с увеличением × 10. Чтобы количественно оценить распределение белков HCN1 и HCN4 в SAN, программное обеспечение ImageJ использовалось для анализа флуоресцентных областей.Пороги красной флуоресценции (HCN1) и зеленой флуоресценции (HCN4) были установлены в диапазоне, исключающем неспецифический фоновый сигнал от окружающей SAN и ткани предсердия. Для всех изображений использовались одинаковые пороговые значения. Оставшуюся площадь SAN измеряли и рассчитывали соотношение площадей HCN1 / HCN4 для областей головы, тела и хвоста. Последовательные поперечные срезы одного и того же SAN инкубировали в течение ночи в растворе Буэна, промывали в течение 10 минут под проточной водопроводной водой и затем окрашивали в течение 20 минут при комнатной температуре с помощью 0.1% Быстрый зеленый раствор. Предметные стекла ополаскивали 1% уксусной кислотой в течение 1 мин с последующей промывкой в ​​течение 5 мин в водопроводной воде. На последнем этапе окрашивания поперечные срезы инкубировали в течение 30 минут в 0,01% растворе сириуса красного. Наконец, слайды обезвоживали (70% этанол, 10 с; 100% этанол, 3 мин; 100% ксилол, 3 мин) перед закреплением с помощью Entellan (Merck KGaA, Германия). Изображения были получены с помощью микроскопа Olympus BX41 и программного обеспечения CellSens 2.3 с использованием объектива × 10. Для количественной оценки красных и зеленых областей использовалась программа ImageJ.Для оценки уровня фиброза был рассчитан процент красных участков в узловой области.

Вестерн-блот

Для выделения белка SAN мыши, ткань предсердия и левого желудочка трехмесячных самок мышей WT и HCN4FEA быстро замораживали в жидком азоте. Образцы гомогенизировали на сухом льду с использованием ступки и пестика и суспендировали в буфере для гомогенизации (2% додецилсульфат натрия, 50 мМ Трис и коктейльная смесь из ингибитора протеиназы). После нагревания при 95 ° C в течение 15 минут с последующим центрифугированием при 1000 × g в течение 10 минут для удаления клеточного дебриса полученный супернатант использовали в вестерн-блот-анализе, как описано ранее 38 .Были использованы следующие антитела: мышиные анти-HCN1 (1: 1000; Abcam, Великобритания), крысиные анти-HCN4 (1: 500; Santa Cruz Biotechnology, США), кроличьи анти-HCN2 L (1: 500 46 ), и мышиный анти-бета-тубулин (E7, 1: 2000; Developmental Studies Hybridoma Bank, США).

Выделение и электрофизиология клеток SAN мышей

Самцов мышей WT и HCN4FEA в возрасте восьми-десяти недель умерщвляли смещением шейки матки под глубокой ингаляционной анестезией, состоящей из 5% изофлурана (CP-Pharma, Германия) в карбогене (5%). O 2 , 95% CO 2 ), и смерть была подтверждена последующим обезглавливанием.Бьющиеся сердца быстро удаляли и переносили в теплый (37 ° C) раствор Тирода (Tyrode III), содержащий: 140 мМ NaCl, 5,4 мМ KCl, 1 мМ MgCl 2 , 1,8 мМ CaCl 2 , 5 мМ HEPES-NaOH ( pH 7,4) и 5,5 мМ D-глюкозы. Область SAN вырезали и делали 2–3 разреза для увеличения поверхности для оптимизации ферментативного переваривания. Затем ткань переносили в раствор с низким содержанием Ca 2+ с низким содержанием Mg 2+ (Tyrode low), содержащий: 140 мМ NaCl, 5,4 мМ KCl, 0.5 мМ MgCl 2 , 0,2 мМ CaCl 2 , 1,2 мМ KH 2 PO 4 , 50 мМ таурин, 5 мМ HEPES-NaOH (pH 6,9) и 5,5 мМ D-глюкоза. Расщепление проводили в сухом блочном нагревателе в течение 26–28 мин (в зависимости от размера ткани) при 37 ° C и 450 об / мин после добавления BSA (1 мг мл -1 , Merck KGaA, Германия), эластазы (18,4 Ед мл. -1 , Merck KGaA, Германия), коллагеназа B (0,3 Ед мл -1 , Roche Diagnostics, Германия) и протеаза (1,8 Ед мл -1 , Merck KGaA, Германия).Затем SAN центрифугировали при 200 × g в течение 2 минут при 4 ° C. Супернатант удаляли, и, следуя тому же протоколу центрифугирования, ткань дважды промывали средой Tyrode low и дважды модифицированной средой «Kraftbrühe» (KB), содержащей: 80 мМ L-глутаминовую кислоту, 25 мМ KCl, 3 мМ MgCl 2 , 10 мМ KH 2 PO 4 , 20 мМ таурина, 10 мМ HEPES-KOH (pH = 7,4), 0,5 мМ EGTA и 10 мМ D-глюкозы. После 3–4 ч восстановления при 4 ° C в 350 мкл среды KB и последующих 15 мин адаптации к RT, клетки SAN механически разделяли путем пипетирования ткани 4–8 раз.Пятьдесят микролитров клеточной суспензии помещали на покровное стекло, покрытое поли-L-лизином, в инкубационной камере, насыщенной паром, и для правильного прикрепления клеток давали седиментацию в течение 15 минут. Затем покровное стекло переносили в записывающую камеру и путем добавления клеток Tyrode III ступенчато реадаптировали до физиологической внеклеточной концентрации Ca 2+ . Для записи с токовым зажимом клетки подвергали суперфузии с Tyrode III при 32 ° C. Для экспериментов с фиксацией напряжения клетки были слиты с внеклеточным раствором, состоящим из 140 мМ NaCl, 5.4 мМ KCl, 1 мМ MgCl 2 , 1 мМ CaCl 2 , 5 мМ HEPES-NaOH (pH 7,4), 5 мМ D-глюкоза, 0,3 мМ CdCl 2 и 2 мМ BaCl 2 при 32 ° C. Пипетки заполняли внутриклеточным раствором, содержащим: 90 мМ аспартат калия, 10 мМ NaCl, 2,0 мМ MgCl 2 , 2,0 мМ CaCl 2 , 5,0 мМ EGTA, 2,0 мМ Na 2 -ATP, 0,1 мМ Na 2 -GTP и 5,0 мМ креатинфосфат (pH 7,2). Для измерений при насыщающих концентрациях цАМФ к раствору добавляли 100 мкМ цАМФ (Merck KGaA, Германия) и корректировали pH.Регистрирующие электроды изготавливали с помощью съемника микроэлектродов WZ DMZ-Universal (Zeitz-Instruments Vertriebs GmbH, Германия). Мы применили цельноклеточную и перфорированную разновидность патч-зажима, как указано в соответствующих экспериментах. Для варианта перфорированного пластыря амфотерицин B (EDQM, Франция) растворяли в ДМСО и добавляли в раствор для пипетки с получением конечной концентрации 200 мкг мл -1 . Данные были записаны с использованием двойного патч-зажимного усилителя HEKA EPC10 USB (HEKA Elektronik, Германия) и Patchmaster v2x90.2 программное обеспечение. Данные анализировали с помощью программы Fitmaster v2x90.2.

Кривые стационарной активации

HCN определяли в конфигурации цельной клетки с помощью шагов гиперполяризации от -150 до -40 мВ с шагом 10 мВ от удерживающего потенциала -40 мВ в течение 4,5 с (интервал между импульсами 20 с), за которым следовали шаг до -150 мВ в течение 500 мс. Вычитался линейный ток утечки. Кинетику активации определяли следующим образом. Кривые тока при -140 мВ соответствовали двойной экспоненциальной функции ( I = I ss + A 1 exp [- t / τ 1 ] + A 2 exp [- t / τ 2 ]) после начальной задержки. I ss представляет собой установившийся ток, а τ представляет собой постоянную времени. Плотность тока рассчитывалась как амплитуда установившегося тока при -140 мВ, деленная на емкость ячейки. Вычитался линейный ток утечки. Постоянные времени, представляющие активацию каналов HCN4 и HCN1, определяли из двойного экспоненциального подбора кривых I f , активированных скачком напряжения до -140 мВ от удерживающего потенциала -40 мВ.

Кальциевые токи регистрировали во внеклеточном растворе без натрия, состоящем из 120 мМ TEA-Cl, 25 мМ HEPES, 10 мМ 4-AP, 2 мМ CaCl 2 , 1 мМ MgCl 2 (TEA-OH pH = 7.4) при 26 ° С. Пипетки заполняли внутриклеточным раствором, содержащим: 135 мМ CsCl, 5 мМ EGTA, 5 мМ HEPES, 4 мМ Mg-ATP, 1 мМ MgCl 2 , 0,1 мМ Na-GTP (CsOH pH = 7,2). Для измерений при насыщающих концентрациях цАМФ к раствору добавляли 100 мкМ цАМФ (Merck KGaA, Дармштадт, Германия) и снова устанавливали pH. Плотности тока I Ca-T + L и I Ca-L определяли при испытательном потенциале -50 мВ от удерживающего потенциала -90 и -60 мВ, соответственно.Для определения I Ca-T пиковый внутренний ток I Ca-L вычитали из I Ca-T + L .

Долговременные записи спонтанного возбуждения с помощью токовых клещей выполнялись в вариации перфорированного пластыря, и были проанализированы записи без пропусков продолжительностью не менее 5 минут. Клетки были классифицированы как «эпизодические срабатывания», когда они демонстрировали непрерывные периоды продолжительностью не менее 10 секунд без спонтанного срабатывания потенциала действия, в течение которых мембранный потенциал оставался на физиологических значениях (среднее MDP ± 10 мВ).Ячейки, в которых не было таких периодов, были отнесены к категории «постоянный огонь». При возникновении эпизодической картины возбуждения определялась разница в мембранном потенциале между началом и окончанием эпизодов отсутствия возбуждения (ΔVm). Для того, чтобы количественно оценить частоту бездымного режима, был рассчитан процент клеток, отображающих различные схемы срабатывания. Общая продолжительность эпизодов отсутствия огня оценивалась и выражалась как процент времени, проведенного в режиме отсутствия огня. Самым коротким эпизодом без стрельбы, включенным в статистику, было 3.5 с. С целью изучения плотности тока I f и процента постоянно и эпизодически активируемых клеток SAN, экспрессирующих I f , регистрировали спонтанную активную активность в вариации перфорированного пластыря в течение 15 минут во время суперфузии с Tyrode III при 32 ° C. Впоследствии Tyrode III был заменен внеклеточным раствором, содержащим CdCl 2 и BaCl 2 , и эксперименты с фиксацией напряжения были выполнены при 32 ° C, как описано ранее. Кривые «доза-ответ» для карбахола определяли следующим образом.Используя вариант перфорированного пластыря, базальную скорость возбуждения спонтанно активных клеток SAN измеряли в течение 1 мин во время суперфузии с раствором Tyrode III. Впоследствии перфузию переключили на Tyrode III, содержащий карбахол (Merck KGaA, Германия), и концентрацию постепенно увеличивали до 10 нМ, 100 нМ и 1 мкМ с последующей промывкой Tyrode III. В анализ были включены только клетки, у которых восстановилось ритмическое возбуждение после вымывания (данные не показаны). Каждую концентрацию вводили в течение 150 с, и кумулятивные кривые доза-ответ строили как интенсивность возбуждения против соответствующей концентрации карбахола.Для изучения действия изопротеренола спонтанная активная активность клеток SAN была впервые зарегистрирована в растворе Tyrode III, не содержащем лекарств, в течение 150 с. После этого промывали изопротеренол (100 нМ) и регистрировали потенциалы действия в течение следующих 5 минут. Эффект TAT-TRIP8b nano определяли следующим образом. Клетки WT обрабатывали Tyrode III, содержащим 10 мкМ TAT-TRIP8b nano 28 , при комнатной температуре в течение 30 минут перед экспериментами. После инкубации были проведены измерения токового зажима в вариации перфорированного пластыря во время суперфузии с раствором Tyrode III, не содержащим пептидов, в течение 60 минут.Во время анализа данных исследователи не знали генотипа. Животные были идентифицированы по целевым номерам.

Телеметрические записи ЭКГ

Подходящие к помету самцы мышей WT и HCN4FEA в возрасте 5–6 месяцев были анестезированы (внутрибрюшинно; 20 мг / кг -1 ксилазин; 100 мг / кг -1 кетамин) и радиотелеметрическими передатчиками ЭКГ ( ETA-F10, Data Sciences International, США) имплантировали во внутрибрюшинную полость. Отведения ЭКГ были подшиты подкожно к верхней правой мышце грудной клетки и верхней левой мышце брюшной стенки, что приблизительно соответствует отведению ЭКГ II.Карпрофен (внутрибрюшинно; 5 мг / кг -1 ; дважды в день в течение 5 дней) применялся для послеоперационной анальгезии. Перед проведением измерений животным давали возможность восстановиться в течение как минимум 14 дней. Аналоговые телеметрические сигналы оцифровывались с частотой 1 кГц и записывались Dataquest A.R.T. программное обеспечение для сбора данных (Data Sciences International, США). Данные собирались за весь период записи у свободно перемещающихся животных. Для фармакологических вмешательств препараты вводили внутрибрюшинно через 2 ч до начала.После этого ЭКГ регистрировали в течение 3–24 ч. Между инъекциями животным давали возможность восстановиться в течение не менее 48 часов. Были использованы следующие концентрации лекарственного средства в [мг кг -1 ]: пропранолол: 20; атропин: 1. Аналитики данных всех экспериментов in vivo, включая данные ЭКГ, не были скрыты от генотипа из-за очевидных различий в следах ЭКГ для WT по сравнению с животными HCN4FEA.

Комбинированные телеметрические записи ЭКГ и артериального давления

Одноплодные 4-месячные самцы мышей WT и HCN4FEA были анестезированы (т.п.; 15 мг кг -1 ксилазина; 100 мг кг -1 кетамина; 1 мг кг -1 ацепромазина). Были имплантированы комбинированные радиотелеметрические передатчики ЭКГ и артериального давления (HD-X11, Data Sciences International, США). Вкратце, датчик давления вводили в дугу аорты через левую общую сонную артерию. Отведения ЭКГ накладывали подкожно на верхнюю правую мышцу грудной клетки и верхнюю левую мышцу брюшной стенки, что приблизительно соответствует отведению ЭКГ II, а центральный блок передатчика подкожно помещали на левый бок.Карпрофен (внутрибрюшинно; 5 мг / кг -1 ; дважды в день в течение 5 дней) применялся для послеоперационной анальгезии. Перед проведением измерений животным давали возможность восстановиться в течение как минимум 14 дней. Аналитики данных всех экспериментов in vivo, включая данные ЭКГ, не были скрыты от генотипа из-за очевидных различий в следах ЭКГ животных дикого типа по сравнению с животными HCN4FEA.

Анализ частоты сердечных сокращений и вариабельности сердечного ритма (ВСР)

Анализ ЭКГ и ВСР выполнялся с использованием ecgAUTO v3.3.5.10 программное обеспечение (EMKA Technologies, Франция). Средняя, ​​минимальная и максимальная частота сердечных сокращений определялась из непрерывных записей в течение 72 часов, 12 часов темноты и 12 часов светового цикла соответственно. Для определения различий в динамике ЧСС гистограммы ЧСС получали с 72-часовыми интервалами путем вычисления средних значений ЧСС каждые 10 с. Значения частоты пульса были объединены с использованием 50 равных распределенных окон в диапазоне от 150 до 950 ударов в минуту. ВСР была определена с использованием анализа, основанного на предыдущих отчетах 1 .Вкратце, для анализа частотной области необработанные полоски ЭКГ из фазы низкой активности проверялись вручную, чтобы подтвердить стабильный синусовый ритм. 103-секундные временные ряды интервалов RR были нанесены в виде тахограмм. Эти тахограммы были интерполированы сплайн-интерполяцией третьей степени с интервалами 50 мс для создания равноудаленных точек, подходящих для быстрого преобразования Фурье (БПФ). После устранения тренда было выполнено БПФ с использованием 1024 спектральных точек и было определено умножение с тремя перекрывающимися наполовину окнами Хэмминга и графики спектральной плотности мощности.Для каждого временного сегмента общая мощность (TP) рассчитывалась как интегральная сумма общей изменчивости после БПФ в зарегистрированном частотном диапазоне (0–4,0 Гц). Кроме того, для каждого временного сегмента частоты среза, ранее определенные как точные для мышей, использовались для разделения сигналов на три основных компонента: очень низкую частоту (VLF: 0,0–0,4 Гц) и низкую частоту (LF: 0,4–1,5 Гц). и высокая частота (HF: 1,5–4,0 Гц). Данные, полученные для каждого временного отрезка, усреднялись. Для анализа во временной области были записаны 2 часа записи ЭКГ в период низкой активности.Стандартное отклонение (SD) всех нормальных интервалов RR в синусовом ритме (SDNN) и квадратный корень из среднего квадрата разностей между последовательными нормальными интервалами RR (RMSSD) были рассчитаны из трех репрезентативных 10-минутных интервалов. Кроме того, для построения графиков Пуанкаре использовалось 20 000 точек данных из очищенных временных рядов RR. Здесь интервалы RR (n; ось x ) были нанесены на график относительно следующего интервала RR (n + 1; ось y ).

Анализ взаимодействия между вагусной активностью, ЧСС и АД.

Серию между сокращениями систолического АД (САД) и интервала RR во время фазы низкой активности исследовали с помощью ecgAUTO v3.3.5.10 программное обеспечение (EMKA technologies, Франция) для спонтанных последовательностей увеличения (последовательности вверх) или уменьшения (последовательности вниз) САД, связанных с параллельными изменениями интервала RR 35 . Длина последовательностей, включенных в анализ, составляла три последовательных удара. Продолжительность трех последовательных сокращений (~ 0,3–1,2 с) мала по сравнению с симпатическим влечением, которое характеризуется очень медленными колебаниями в диапазоне 2–10 с 36 . Следовательно, симпатический драйв можно считать постоянным в течение временного окна наблюдения.Напротив, изменения в вагусе находятся в диапазоне миллисекунд (200-650 мс) 36,37 ; следовательно, изменения интервала RR во время последовательности почти полностью связаны с изменениями активности блуждающего нерва 34,36,37 . Задержка между систолическим АД и ЧД составляла 1 удар, порог изменений АД и ЧД составлял 0,5 мм рт.ст. и 2 мс соответственно, а наклон линии регрессии на графиках ЧД / САД имел коэффициент корреляции> 0,85. Участки ЭКГ, показывающие изоритмическую атриовентрикулярную диссоциацию в записях ЭКГ HCN4FEA, были исключены, чтобы избежать неправильной интерпретации снижения АД из-за аритмии.

Внутрисердечное электрофизиологическое исследование

Однопометных самцов мышей WT и HCN4FEA в возрасте 2–3 месяцев анестезировали изофлураном и измеряли стандартные интервалы в отведениях от 6 конечностей. Для записи внутрисердечной электрограммы использовали цифровую электрофизиологическую лабораторию (EP Tracer, CardioTek, Нидерланды). Операционная зона подвергалась местной анестезии путем подкожной инъекции ксилокаина (1,7 мМ кг -1 ). Катетер с октаполярным электродом 0,54 мм (1,7 французского) (катетер для мыши CIBer, NuMed Inc., США) вводили через правую яремную вену в правое предсердие и желудочек, руководствуясь морфологией внутрисердечных электрических сигналов. Восемь электродов напрямую контактируют с эндокардиальной поверхностью сердца. Биполярные записи деполяризации предсердий и желудочков были получены от соседних электродов в верхнем правом предсердии сразу за верхней полой веной и верхушкой правого желудочка соответственно. Стандартные клинические протоколы электрофизиологической стимуляции использовались для определения электрофизиологических параметров, включая время восстановления синусового узла (SNRT), время синоатриального проведения (SACT), эффективный рефрактерный период синусового узла (SNERP), рефрактерные периоды предсердий, AV-узла и желудочка как а также свойства AV-узловой проводимости, включая периодичность Венкебаха (WBP) 20 .Импульсы подавали с удвоенным диастолическим порогом (1 мА) с длительностью импульса 1,0 мс. Каждая мышь проходила идентичный протокол стимуляции и запрограммированной стимуляции. Функцию синусового узла оценивали путем косвенного измерения SNRT путем кардиостимуляции в течение 30 с при различной продолжительности цикла, начиная с длины цикла стимуляции чуть ниже внутренней длины синусового цикла и измеряя продолжительность цикла возврата, которая соответствует интервалу между последний импульс стимуляции и первый спонтанный синусовый узел вызвали активацию предсердий.После паузы в 60 с протокол повторяли, постепенно уменьшая длину цикла стимуляции с шагом 10 мс, пока не была достигнута длина цикла стимуляции 80 мс. SNRT с поправкой на скорость (cSNRT) вычисляли путем вычитания средней длины синусового цикла (SCL) из SNRT. SACT косвенно определяли с помощью техники преждевременной стимуляции предсердий, которая проводилась, как описано 20 . Ответы показаны на дополнительных рисунках 1b, c. Преждевременные стимулы предсердий вводились через стимулирующий электрод во время спонтанного синусового ритма.Весь цикл синусового узла сканировали до 80 дополнительных стимулов. Измеряли длину спонтанного синусового цикла (интервал A1A1), интервал сцепления преждевременного стимула предсердия (A1A2), длину цикла возврата предсердия (A2A3) и длину цикла после возврата (A3A4). Дополнительный рис. 1b иллюстрирует ответ SAN на преждевременную стимуляцию предсердий. При постепенном уменьшении интервала сцепления преждевременного стимула предсердия (A1A2) циклы возврата A2A3 постепенно удлиняются. Соответствующие точки данных A2A3 попадают на верхнюю диагональную линию, обозначающую полностью компенсирующие паузы [A1A2 + A2A3 = 2 (A1A1)].Пауза является компенсирующей, потому что поздняя диастолическая деполяризация предсердий не проникает и не сбрасывает SAN до того, как она сработает самопроизвольно. Как только интервал соединения A1A2 уменьшается ниже определенной точки длины спонтанного цикла, циклы возврата A2A3 больше не являются полностью компенсирующими. Точки данных опускаются ниже линии полной компенсирующей паузы, но остаются больше ожидаемой длины синусового цикла (A1A1; горизонтальная линия). У некоторых животных во время этой фазы A2A3s оставался постоянным, давая плато.A1A2 плюс A2A3 короче, чем удвоенный интервал A1A1, потому что преждевременная деполяризация предсердий проникает, деполяризует и сбрасывает SAN до его следующего ожидаемого спонтанного срабатывания. Пост-возвратный цикл A3A4, который является первым самопроизвольным циклом после возвратного, также был нанесен (темные кружки). Сравнивая интервалы A3A4 с интервалами A1A1, можно оценить вариабельность синусового цикла и автоматичность SAN. Для расчета SACT мы определили интервал A2A3, который отклоняется от диагональной линии.Интервал A1A2 в этой точке представляет собой самый короткий интервал преждевременных сокращений, фронт ретроградного возбуждения которого не достигает синусового узла, тогда как более ранние преждевременные сокращения сбрасывают кардиостимулятор 20 . Интервал возврата A2A3 в этот момент за вычетом спонтанного предсердного цикла A1A1 эквивалентен сумме времени проведения от предсердия до синусового узла плюс от синусового узла до предсердия. Половина общей суммы времени проводимости дает время синоатриальной проводимости. Этот расчет основан на предположении, что SACT отражает время, в течение которого стимуляционный импульс A1 входит в SAN, который затем сбрасывается, плюс длительность спонтанного синусового цикла плюс время, необходимое для последующего спонтанного сокращения для выхода из SAN, и что время входа и выхода из SAN примерно одинаково.Атриовентрикулярный узловой рефрактерный период (AVNERP) оценивали с помощью запрограммированной стимуляции предсердий. Чтобы обеспечить разумную стабилизацию рефрактерности, преждевременному стимулу предсердия (S2) предшествовала серия из 8 ритмов (S1). Последовательность из 8 стимулов применялась с продолжительностью цикла S1S1 100 мс, за которой следовало один дополнительный стимул (S2). Интервал связи S1S2 был ступенчато уменьшен с шагом 2 мс до 20 мс. Впоследствии протокол был повторен после времени восстановления 30 с с использованием продолжительности цикла S1S1 90 мс и 80 мс.AVNERP был определен как самый длинный интервал стимуляции S1S2 с потерей AV-узловой проводимости. Для каждого животного определяли минимальную длину цикла, необходимую для поддержания АВ-проводимости 1: 1, длину цикла стимуляции Венкебаха и максимальную длину цикла стимуляции, вызывающую АВ-блокаду 2: 1. Эффективный рефрактерный период желудочков (VERP) оценивался аналогично AVNERP. Интервалы S1S1 составляли 100, 90 и 80 мс. Интервал связи S1S2 был ступенчато уменьшен с шагом 2 мс до 30 мс. Используя аналогичный протокол, нельзя было достоверно определить эффективный рефрактерный период правого предсердия (AERP) из-за наложения предсердных и желудочковых электрограмм с интервалами преждевременного связывания менее 40 мс.Чтобы обойти эту проблему, был использован следующий трехэтапный протокол: после применения серии из 8 стимулов S1 был дан дополнительный стимул (S2), чтобы вызвать блокаду AV-проводимости с интервалом связи S1S2, на 5 мс короче, чем определенный AVNERP, с последующим все более преждевременный S3. AERP был определен как самый длинный S2S3 без предсердной реакции. Кривые AV-проводимости определяли по данным, полученным с помощью протокола AVERP, описанного выше, путем построения интервалов V1V2 или h2h3 в зависимости от A1A2. Кривые задержки были построены путем построения интервалов A2V2 в сравнении с интервалами A1A2, как в ссылке. 20 . Дополнительный рис. 1d показывает ответы на преждевременную стимуляцию в одном эксперименте. Поскольку предсердные реакции возникали прогрессивно раньше в сердечном цикле, желудочковые интервалы также постепенно сокращались. До интервала связи приблизительно 85 мс уменьшение V1V2 пропорционально уменьшению A1A2, и поэтому точки попадают на линию, которая представляет собой теоретическую кривую отсутствия задержки AV-проводимости. Для точек на этой кривой V1V2 равно A1A2. При более коротких интервалах A1A2 V1V2 уменьшается меньше, чем A1A2.Точки лежат над линией, указывая на то, что AV-проведение преждевременного импульса A2 задерживается. Точка, в которой точки начинают отклоняться от линии, отмечает начало относительного рефрактерного периода системы AV-проводимости. При критическом интервале A1A2 V1V2 достигает минимума, а затем начинает увеличиваться, даже несмотря на то, что предсердный интервал сокращается еще больше, пока не произойдет полная блокировка проведения преждевременного импульса. По этому графику функциональный рефрактерный период системы AV-проводимости был определен как самый короткий интервал V1V2.Мы также построили интервалы между ответами пучка Гиса (интервалы h2h3) и преждевременными стимуляциями предсердий (A1A2) для того же эксперимента. Интервалы h2h3 точно соответствуют значениям V1V2, что указывает на то, что увеличение времени АВ-проводимости, происходящее при преждевременной стимуляции предсердий, было полностью ограничено областью АВ-узла, то есть между электрограммой предсердия и пучка Гиса. Наконец, латентность A2V2 была построена в зависимости от интервалов A1A2. По мере уменьшения интервалов A1A2 время ожидания A2V2 увеличивается (дополнительный рис.1е). Удлинение A2V2 незначительно для относительно длинных интервалов A1A2 и становится больше по мере сокращения этих интервалов. Диагональная линия показывает удлинение A2V2, равное укорочениям A1A2 (наклон = -1).

Сердца Лангендорфа

Самок мышей WT и HCN4FEA в возрасте 10 недель анестезировали 5% изофлураном в карбогене (95% O 2 , 5% CO 2 ) и умерщвляли путем смещения шейных позвонков. После декапитации сердце осторожно вырезали и помещали в насыщенный кислородом теплый (37 ° C) буфер Кребса-Хенселейта, содержащий 118.5 мМ NaCl, 20 мМ NaHCO 3 , 4,7 мМ KCl, 1,2 мМ MgSO 4 , 1,8 мМ CaCl 2 , 1,2 мМ Kh3PO 4 и 11 мМ глюкозы (pH = 7,3). Немедленно аорту канюлировали, устанавливали на аппарате Лангендорфа (Basic Langendorff System, Hugo Sachs Elektronik & Harvard Apparatus GmbH, Германия) и ретроградно перфузировали буфером Кребса-Хенселейта при постоянном давлении 80 мм рт. ЭКГ регистрировали (PowerLab 8/35, LabChart 8, Animal Bio Amp, ADInstruments, Новая Зеландия), помещая электроды в правое предсердие и левый желудочек.Перед измерением сердца уравновешивали в течение ~ 10 мин. Средние базальные параметры ЧСС и ВСР определяли по тахограммам ЧСС за 120 с. Катетеризация правых отделов сердца Лангендорфа проводилась следующим образом. Трехмесячным самцам мышей WT и HCN4FEA внутрибрюшинно вводили гепарин (100 МЕ кг -1 ). Через десять минут после инъекции мышей анестезировали и получали сердца Лангендорфа, как описано выше. Для записи внутрисердечной электрограммы использовали цифровую электрофизиологическую лабораторию (EP Tracer, CardioTek, Нидерланды).Октаполярный электродный катетер 0,54 мм (1,7 французского языка) (катетер для мышей CIBer, NuMed Inc., США) вводили через правую яремную вену в правое предсердие и желудочек. Установленные сердца были уравновешены перед началом измерений. 100 мкл 200 нМ изопротеренола в буфере KH вводили через порт для инъекции в течение нескольких секунд для индукции IAVD. Для записи и анализа использовались программы LabChart8 (ADInstruments, Новая Зеландия) и EP-Tracer_V1.05 (Schwarzer Cardiotek, Германия). Стимуляцию блуждающего нерва в сердце с перфузией по Лангендорфу проводили следующим образом.Трехмесячным самкам мышей WT и HCN4FEA внутрибрюшинно вводили гепарин (100 МЕ кг -1 ). Через десять минут после инъекции мышей анестезировали 5% изофлураном и умерщвляли смещением шейного отдела позвоночника. Небольшой разрез на правой стороне шеи давал доступ к блуждающему нерву, и вокруг нерва был наложен шелковый шов. Затем сердца, объединенные с интактным блуждающим нервом, были осторожно удалены и установлены на аппарате Лангендорфа, как описано ранее. Для нервной стимуляции использовался изготовленный на заказ электрод Ag / AgCl.Длительность импульса 1 мс при 4 В применялась в течение 30 с с использованием частот стимуляции 3, 5, 10, 20 и 30 Гц. Между каждой стимуляцией вводили период восстановления продолжительностью 2 минуты. Для записи и анализа использовалась программа LabChart8 (ADInstruments, Новая Зеландия). Расчеты были выполнены с помощью Origin 2015. Синусовая пауза определялась как два последовательных удара с интервалом RR> в два раза превышающим средний RR во время стимуляции. Во время анализа данных исследователи не знали генотипа. Животные были идентифицированы по целевым номерам.

Оптическая визуализация

Препараты сердца Лангендорфа 3-месячных самок мышей использовали для оптической визуализации и выполняли, как описано выше, со следующими изменениями. Вкратце, мышам внутрибрюшинно вводили гепарин (100 МЕ кг -1 ). Через десять минут после инъекции мышей умерщвляли, как описано выше, и эксплантированные сердца помещали в теплый (37 ° C) раствор Тирода, насыщенный кислородом 95% O 2 5% CO 2 , и немедленно канюлировали.Раствор Тироде содержал (в мМ) 128,2 NaCl, 4,7 KCl, 1,19 NaH 2 PO 4 , 1,05 MgCl 2 , 1,3 CaCl 2 , 20,0 NaHCO 3 , 11,1 глюкозы; pH = 7,35 47 . Легкое, тимус и жировая ткань были рассечены и удалены. Канюлю устанавливали на изготовленный на заказ аппарат Лангендорфа, и сердце ретроградно перфузировали и подвергали переливанию раствором Тироде, пропущенным через фильтр 10 мкм. Давление перфузии в канюле контролировали с помощью датчика давления (MLT0699, ADInstruments, Новая Зеландия) и поддерживали постоянное давление 80 мм рт. Ст., Как описано ранее 48 .Следы ЭКГ записывали (PowerLab 8/35, LabChart 8, Animal Bio Amp, ADInstruments, Новая Зеландия) путем размещения игольчатых электродов рядом с изолированным сердцем в приблизительной конфигурации Einthoven I. Для устранения артефактов движения вводили 1 мл блеббистатина (Cayman Chemical Company, США), растворенного в ДМСО (10 мг / мл -1 ) и разбавленного в растворе Тироде до конечной концентрации 0,2 мг / мл -1 . медленно через лекарственный порт, расположенный рядом с перфузионной канюлей.После уравновешивания в течение 10 минут 1 мл Di-4-ANEPPS (Merck KGaA, Германия) растворяли в ДМСО (1,25 мг мл -1 ) и разбавляли в растворе Тироде до получения конечной концентрации 37,5 мкг мл -1. , был применен через тот же порт. После 15-минутного уравновешивания устанавливали сердца Лангендорфа. Высокоскоростная комплементарная металл-оксид-полупроводниковая (CMOS) камера (MiCAM05 Ultima-L Single Camera System, SciMedia, США) обращена к задней стороне сердца, что позволяет хорошо видеть желудочки, SAN и оба предсердия. .Оптическое устройство состояло из возбуждающего света, генерируемого галогенным источником света мощностью 150 Вт (MHAB-150W, Mortitex, Япония), полосового фильтра 531/40 нм и системы разделения луча флуоресценции (THT-FLSP Box, SciMedia, США). Излучаемый свет фильтровали с помощью длиннопроходного фильтра с длиной волны 600 нм. Полученные флуоресцентные сигналы собирались на пиксель и оцифровывались с помощью программного обеспечения производителя (программное обеспечение для сбора данных MiCAM05, версия 2.5.4, Brainvision Inc., Япония). Для оптического изображения использовались следующие настройки; частота дискретизации 2 кГц, номер кадра 4096, пространственное разрешение примерно 100 мкм / пиксель (получено через конденсорную линзу (50 мм, M5095 + AD, SciMedia) и 1.Объектив с 6-кратным увеличением (Planapo, SciMedia, США). Фоновая флуоресценция оптических данных автоматически удалялась, а сигналы инвертировались, чтобы соответствовать потенциалам действия. Для обработки данных использовалось программное обеспечение производителя для анализа (BV_Ana Ver. 1604, Brainvision Inc., Япония), а также графический пользовательский интерфейс на основе MATLAB (ref. 49 , RHYTHM 2012). Карты изохронной активации были построены для визуализации первого сайта активации и распространения потенциала действия через ткань во время синусового ритма, ритма ускользания узлов и IAVD в сердцах мышей HCN4FEA.

Оптическая визуализация биатриальных препаратов SAN выполнялась по той же процедуре, что и описанная выше для препаратов сердца Лангендорфа, со следующей модификацией. Вкратце, биатриальные препараты 12-недельных самок мышей оптически картировали в базовых условиях и после применения карбахола. После катетеризации и перфузии сердца SAN рассекали вместе с правым и левым предсердием, верхней полой веной, нижней полой веной, AV-соединением и закрепляли булавками, чтобы обнажить эндокардиальную поверхность, как описано ранее 50 .Эксплантат SAN непрерывно переливали раствором Тироде (37 ° C). Электрические записи были выполнены с использованием трех игольчатых электродов для расчета частоты сердечных сокращений и параметров ВСР. Для выполнения записи оптического изображения использовали блеббистатин в той же концентрации (Cayman Chemical Company, США) и Di-4-ANEPPS (Merck KGaA, Германия), как описано выше. Непосредственно на препарат наносили блеббистатин, а через 10 мин — Di-4-ANEPPS. После 15 мин уравновешивания препарат SAN был нанесен на карту оптически.Определено местонахождение ведущего узла кардиостимулятора и SACT 47,51 . После базальных измерений карбахол (Merck KGaA, Германия) (1 мкМ в растворе Тироде) подавали через перфузионную систему в течение 5–7 минут до достижения устойчивого состояния. Было определено место максимального смещения ведущего кардиостимулятора, и расстояние до ведущего участка кардиостимулятора в базовых условиях было рассчитано и нормализовано к размеру препарата.

Биатриальные препараты, содержащие интактный правый блуждающий нерв, получали, как препараты, описанные выше, за исключением того, что правый блуждающий нерв был сохранен.Блуждающий нерв стимулировали при 4 В, шириной импульса 1 мс, 20 Гц в течение 30 с. 52 . Расположение ведущего участка кардиостимулятора определялось, как описано выше.

Конфокальная кальциевая визуализация эксплантов SAN

Интактные препараты SAN 12-недельных самок животных WT и HCN4FEA получали, как описано выше, и загружали индикатором кальция Fluo-4 AM (Thermo Fisher Scientific, США) при комнатной температуре в течение 45 секунд. мин. Для этого Fluo-4 AM растворяли в ДМСО (2 мМ), разбавляли 1: 1 Pluronic F 127 (13% в H 2 O) (Merck KGaA, Германия) и добавляли к раствору Tyrode для достижения конечной цели. концентрация 20 мкМ Fluo-4 AM.После этого препараты непрерывно переливали раствором Тироде, содержащим блеббистатин (0,2 мг мл -1 ) при 28 ° C. Сигналы кальция из области головы, тела и хвоста SAN регистрировались с помощью конфокального микроскопа Leica SP8 с объективом с водяной линзой 20x. Каждый кадр (440 мкм²) записывался в течение 10 с с помощью конфигурации линейного сканирования полупроводникового лазера с оптической накачкой (OPSL) (скорость сканирования 8 Гц, 28 кадров / с). Использовали длину волны возбуждения 488 нм, и собирали эмиссию> 500 нм.Подсчитывали клетки, демонстрирующие высоко локализованное и спонтанное высвобождение Ca 2+ во время диастолы, и нормировали на общую измеренную площадь поверхности. Анализ изображений проводился с использованием программного обеспечения Leica LasX. Изменение интенсивности флуоресценции (ΔF) оценивали после вычитания фона и нормализовали к исходной флуоресценции F 0 . После базальных измерений TAT-TRIP8b nano (15 мкМ в растворе Тирода) добавляли к 4 препаратам дикого типа, и после 30 мин инкубации образцы ткани сканировали, как описано выше.

Грунтовка список

HCN1 для: CTGCTGCAGGACTTCCCACCA, HCN1 оборот: ATGCTGACAGGGGCTTGGGC, HCN2 для: CAGGAACGCGTGAAGTCGGCG, HCN2 оборот: TCCAGGGCGCGGTGGTCTCG, HCN3 для: TGGCCATGGACCGGCTTCGG, HCN3 оборот: GAGCCAGGCCCCGAACACCAC, HCN4 для: AGGGCCTTCGAGACGGTTGCGC, HCN4 оборот: GGCCATCTCACGGTCATGCCG, ALAS для: TCGCCGATGCCCATTCTTATC , Увы, rev: GGCCCCAACTTCCATCATCT.

Количественная оценка и статистический анализ

Статистический анализ выполняли с использованием программы Origin 2015 (OriginLab Corporation, США).Все данные представлены как среднее ± стандартная ошибка среднего. N представляет количество животных, препаратов или клеток, как указано в файлах дополнительных данных. Для всех статистических тестов p <0,05 считалось значимым (*** p <0,001, ** p <0,005, * p <0,05, ns = статистически недостоверно p > 0,05). Различия между двумя группами анализировали с помощью непарного двухвыборочного теста Стьюдента t . Значения p были скорректированы с использованием поправки Холма – Бонферрони, как указано в файлах дополнительных данных.Эксперименты с двумя разными переменными были проанализированы с помощью двухфакторного дисперсионного анализа. В случае значимости анализ сопровождался тестом множественного сравнения Холма – Сидака. Для параметров EPS, которые были определены при различных интервалах связывания, данные были проанализированы с помощью двустороннего дисперсионного анализа с повторными измерениями на основе общей линейной модели (GLM) или модели смешанных эффектов (REML) в случае отсутствия данных из-за технических проблем. Для эксперимента, в котором константы времени активации и дезактивации HCN-канала определялись при различных тестовых потенциалах в клетках HEK293, данные были проанализированы с помощью трехфакторного дисперсионного анализа, поскольку измерения включают три независимых фактора.Этими факторами являются (1) генотип (WT и HCN4FEA), (2) лекарственное средство (без цАМФ и с ним) и (3) потенциал (несколько тестовых потенциалов и повторные измерения в одних и тех же образцах). Трехфакторный дисперсионный анализ ANOVA проверяет взаимозависимости трех факторов с учетом повторных измерений. Для данных, которые не подчиняются нормальному распределению, или для экспериментов с низкими числами n ( n = 3) мы применили непараметрический U-критерий Манна – Уитни.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этой статьей.

Регулирование активности ClC-2 с помощью SPAK и OSR1 — FullText — Исследование почек и артериального давления 2014, Vol. 39, № 4

Абстрактные

Предпосылки / цели: SPAK (SPS1-родственная пролин / аланин-богатая киназа) и OSR1 (чувствительная к окислительному стрессу киназа 1) являются мощными регуляторами разнообразных транспортных процессов. Обе киназы активируются за счет сокращения клеток и участвуют в стимуляции увеличения объема регуляторных клеток (RVI).Выполнение RVI предполагает ингибирование каналов Cl . В настоящем исследовании изучали, регулируют ли SPAK и / или OSR1 активность канала Cl ClC-2. Методы: С этой целью ClC-2 экспрессировался в ооцитах Xenopus laevis с дополнительной экспрессией SPAK дикого типа или без нее, конститутивно активным SPAK T233E , нечувствительным к WNK1 неактивным SPAK T233A , каталитически неактивным SPAK D212A , OSR1 дикого типа, конститутивно активный OSR1 T185E , нечувствительный к WNK1 неактивный OSR1 T185A и каталитически неактивный OSR1 D164A .Активность канала Cl определяли с помощью двухэлектродных фиксаторов напряжения. Результаты: Экспрессия ClC-2 сопровождалась появлением проводимости (G Cl ), которая значительно снижалась после совместной экспрессии SPAK дикого типа, SPAK T233E , OSR1 дикого типа или OSR1 T185E , но не путем совместного выражения SPAK T233A , SPAK D212A , OSR1 T185A или OSR1 D164A . Ингибирование вставки ClC-2 брефельдином A (5 мкМ) приводило к снижению G Cl , которое было аналогичным в отсутствие и в присутствии SPAK или OSR1, предполагая, что SPAK и OSR1 не ускоряли извлечение белка ClC-2. из клеточной мембраны. Заключение: SPAK и OSR1 являются мощными негативными регуляторами регулятора клеточного объема Cl канала ClC-2.

© 2014 S. Karger AG, Базель


Введение

SPAK (связанная с SPS1 пролин / аланин-богатая киназа) [1,2,3] и OSR1 (чувствительная к окислительному стрессу киназа 1) [4,5] являются родственными киназами, участвующими в регуляции транспорта ионов и таким образом кровяное давление. Активность SPAK и OSR1 контролируется киназами WNK (with-no-K [Lys]) [1,6,7,8,9], которые снова участвуют в регуляции транспорта ионов и артериального давления [10,11 , 12,13,14].Наряду с этим мутации генов, кодирующих киназы WNK, могут приводить к гипертонии и гиперкалиемии [7,8,15,16]. Носители, активируемые SPAK и OSR1, включают котранспортер Na + -Cl и котранспортер Na + , K + , 2Cl [4,5,6,9,10,17,18, 19,20,21,22,23,24,25]. Более того, OSR1 и / или SPAK могут модифицировать другие транспортные системы, включая связанный с Na + переносчик глюкозы SGLT1 [26], связанный с Na + транспорт фосфата [27,28] и обменник Na + / H + . [29].SPAK и OSR1 активируются за счет сокращения клеток, а киназы участвуют в уменьшении регуляторного объема клеток [30]. Регулирование клеточного объема частично осуществляется с помощью каналов Cl [31,32,33], включая повсеместно экспрессируемый внутрь выпрямляющий канал Cl ClC-2 [33,34]. Уменьшение клеток приводит к ингибированию каналов Cl , таким образом сокращая потерю клеточного Cl [35,36].

В настоящем исследовании изучали, модифицируют ли SPAK и / или OSR1 активность канала ClC-2 Cl .С этой целью кРНК, кодирующую ClC-2, инъецировали в ооциты Xenopus laevis с или без кРНК, кодирующей SPAK дикого типа, нечувствительный к WNK1 SPAK T233A , конститутивно активный SPAK T233E , каталитически неактивный SPAK D212A , дикий типа OSR1, нечувствительный к WNK1 неактивный OSR1 T185A , конститутивно активный OSR1 T185E и каталитически неактивный OSR1 D164A [9]. Активность ClC-2 в этих ооцитах оценивали по проводимости клеточной мембраны, которую количественно определяли с помощью фиксации напряжения на двух электродах.

Материалы и методы

Конструкции

Конструкции, кодирующие человеческий ClC-2 дикого типа [37,38], SPAK дикого типа, нечувствительный к WNK1 неактивный SPAK T233A , конститутивно активный SPAK T233E и каталитически неактивный SPAK D212A , OSR1 дикого типа, нечувствительный к WNK1 неактивный OSR1 T185A , конститутивно активный OSR1 T185E и каталитически неактивный OSR1 D164A [9] были использованы для генерации кРНК, как описано ранее [39,40].Все мутанты любезно предоставлены Дарио Алесси.

Зажим напряжения в ооцитах Xenopus laevis

Ооциты Xenopus laevis получали, как описано ранее [41]. Если не указано иное, 15 нг кРНК, кодирующей ClC-2, вводили в первый день и 10 нг кРНК, кодирующей SPAK, SPAK T233A , SPAK T233E , SPAK D212A , OSR1, OSR1 T185A , OSR1 T185E или OSR1 D164A вводили на второй день или в тот же день после подготовки ооцитов [27,42].Ооциты поддерживали при 17 ° C в растворе ND96-A, содержащем (в мМ): 88,5 NaCl, 2 KCl, 1 MgC1 2 , 1,8 CaC1 2 , 2,5 NaOH, 5 HEPES, 5 пируват натрия (C 3 H 3 NaO 3 ) pH 7,4, гентамицин (100 мг / л), тетрациклин (50 мг / л), ципрофлоксацин (1,6 мг / л) и теофилин (90 мг / л) [43]. Где указано, к соответствующим растворам добавляли брефельдин А (5 мкМ) [44]. Эксперименты по фиксации напряжения проводили при комнатной температуре через 3 дня после инъекции.Двухэлектродные записи с фиксацией напряжения [45] были получены с использованием импульсного протокола 10-секундных импульсов от -140 мВ до +40 мВ с шагом 20 мВ. Промежуточное удерживающее напряжение составляло -60 мВ. Данные фильтровались с частотой 2 кГц и записывались с помощью преобразователя DigiData 1322A и программного обеспечения для сбора и анализа данных pClamp 9.2 (Axon Instruments, США) [46]. Суперфузат (ND96) содержал (в мМ): 93,5 NaCl, 2 KCl, 1,8 CaCl 2 , 1 MgCl 2 , 2,5 NaOH и 5 HEPES, pH 7,4. Скорость потока суперфузии составляла прибл.20 мл / мин, а полный обмен раствора в ванне достигался примерно за 10 с [47, 48].

Статистический анализ

Данные представлены в виде средних значений ± SEM, n представляет количество ооцитов. Все эксперименты с фиксацией напряжения повторяли по крайней мере с 3 партиями ооцитов; во всех повторах были получены качественно похожие данные. Данные были проверены на значимость с помощью ANOVA. Статистически значимыми считались результаты с p <0,05.

Результаты

В данном исследовании изучали, влияют ли SPAK (связанная с STE20 / SPS1 киназа, богатая пролином / аланином) и OSR1 (киназа 1, реагирующая на окислительный стресс) на активность каналов ClC-2 Cl .С этой целью кРНК, кодирующую ClC-2, инъецировали в ооциты Xenopus laevis с дополнительной инъекцией кРНК, кодирующей SPAK или OSR1, или без нее, и определяли проводимость клеточной мембраны с использованием двухэлектродного фиксатора напряжения. В ооцитах, которым вводили воду, проводимость клеточной мембраны была низкой (рис. 1). Как показано на фиг. 1, экспрессия ClC-2 приводит к заметному увеличению проводимости клеточной мембраны. Как показано на фиг. 1, проводимость клеточной мембраны ClC-2, экспрессирующих ооцитов Xenopus laevis , значительно снижалась за счет дополнительной экспрессии SPAK дикого типа.Сходным образом, коэкспрессия OSR1 сопровождалась значительным снижением проводимости клеточной мембраны в ClC-2, экспрессирующем ооцитов Xenopus laevis (рис. 2).

Рис. 1

Влияние коэкспрессии SPAK дикого типа на проводимость Cl в ооцитах Xenopus laevis , экспрессирующих ClC-2. A: Типичные исходные записи, показывающие токи в ооцитах Xenopus laevis , инъецированных водой DEPC (a), а также в ооцитах, экспрессирующих ClC-2 без (b) или с (c) дополнительной коэкспрессией SPAK дикого типа.B: Среднее арифметическое ± SEM (n = 10-31) тока (I) как функции разности потенциалов на клеточной мембране (V) в ооцитах Xenopus laevis , инъецированных водой (кружки), экспрессирующих ClC-2 один (квадраты) или экспрессирующий ClC-2 вместе со SPAK дикого типа (треугольники). C: Среднее арифметическое ± SEM (n = 10-31) проводимости, рассчитанной путем линейной аппроксимации I / V-кривых, показанных на B, между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных водой (пунктирная полоса) , экспрессирующие только ClC-2 (белая полоса) или экспрессирующие ClC-2 вместе со SPAK дикого типа (черная полоса).* (p <0,05) указывает на статистически значимое отличие от экспрессии только ClC-2.

Рис. 2

Влияние коэкспрессии OSR1 дикого типа на проводимость Cl в ооцитах Xenopus laevis , экспрессирующих ClC-2. A: Типичные исходные записи, показывающие токи в ооцитах Xenopus laevis , инъецированных водой DEPC (a), а также в ооцитах, экспрессирующих ClC-2 без (b) или с (c) дополнительной коэкспрессией OSR1 дикого типа. B: Среднее арифметическое ± SEM (n = 16-34) тока (I) как функции разности потенциалов на клеточной мембране (V) в ооцитах Xenopus laevis , инъецированных водой (кружки), экспрессирующих ClC-2 один (квадраты) или экспрессирующий ClC-2 вместе с OSR1 дикого типа (треугольники).C: Среднее арифметическое ± SEM (n = 16-34) проводимости, рассчитанной путем линейной аппроксимации I / V-кривых, показанных на B, между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных водой (пунктирная полоса) , экспрессирующие только ClC-2 (белая полоса) или экспрессирующие ClC-2 вместе с OSR1 дикого типа (черная полоса). ** (р <0,01) указывает на статистически значимое отличие от экспрессии только ClC-2.

Эффект SPAK дикого типа имитировал конститутивно активный мутант SPAK T233E .Соответственно, проводимость была значительно ниже в ооцитах Xenopus laevis , экспрессирующих ClC-2 вместе с SPAK T233E , чем в ооцитах Xenopus laevis , экспрессирующих только ClC-2 (фиг. 3). Напротив, активность ClC-2 существенно не изменялась нечувствительным к WNK1 неактивным SPAK T233A или каталитически неактивным SPAK D212A (фиг. 3).

Рис. 3

Эффект экспрессии конститутивно активных SPAK T233E , неактивного SPAK T233A и каталитически неактивного SPAK D212A на проводимость Cl в ооцитах Xenopus laevis Xenopus laevis , экспрессирующих ClC-2.A: Типичные исходные записи, показывающие токи в ооцитах Xenopus laevis , инъецированных водой DEPC (a), а также в ооцитах, экспрессирующих ClC-2 без (b) или с дополнительной коэкспрессией конститутивно активного SPAK T233E (c), неактивный SPAK T233A (d) и каталитически неактивный SPAK D212A (e). B: Среднее арифметическое ± SEM (n = 18-25) тока (I) как функции разности потенциалов на клеточной мембране (V) в ооцитах Xenopus laevis , инъецированных водой (черные кружки), экспрессирующих ClC- 2 (черные квадраты) или экспрессирующие ClC-2 вместе с конститутивно активным SPAK T233E (черные треугольники), неактивным SPAK T233A (белые ромбы) и каталитически неактивным SPAK D212A (белые квадраты).C: Среднее арифметическое ± SEM (n = 18-25) проводимости, рассчитанной путем линейной аппроксимации I / V-кривых, показанных на B, между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных водой (пунктирная полоса) , экспрессирующие только ClC-2 (белая полоса) или экспрессирующие ClC-2 вместе с конститутивно активным SPAK T233E (черная полоса), неактивным SPAK T233A (темно-серая полоса) и каталитически неактивным SPAK D212A (светло-серая полоса) . *** (p <0,001) указывает на статистически значимое отличие от экспрессии только ClC-2.

Эффект OSR1 дикого типа имитировал конститутивно активный мутант OSR1 T185E . Опять же, коэкспрессия OSR1 T185E значительно снижает проводимость клеточной мембраны ClC-2, экспрессирующих ооцитов Xenopus laevis , а проводимость была значительно ниже в ооцитах Xenopus laevis , экспрессирующих ClC-2 вместе с OSR1 T185E , чем в Xenopus laevis laevis. ооцитов, экспрессирующих только ClC-2 (фиг. 4). Напротив, активность ClC-2 не претерпевала значительных изменений при коэкспрессии нечувствительного к WNK1 неактивного OSR1 T185A или коэкспрессии каталитически неактивного OSR1 D164A (рис.4).

Рис. 4

Влияние экспрессии конститутивно активного OSR1 T185E , неактивного OSR1 T185A и каталитически неактивного OSR1 D164A на проводимость Cl в ооцитах Xenopus laevis Xenopus laevis, экспрессирующих ClC-2. A: Типичные исходные записи, показывающие токи в ооцитах Xenopus laevis , инъецированных водой DEPC (a), а также в ооцитах, экспрессирующих ClC-2 без (b) или с дополнительной коэкспрессией конститутивно активного OSR1 T185E (c), неактивный OSR1 T185A (d) и каталитически неактивный OSR1 D164A (e).B: Среднее арифметическое ± SEM (n = 21-25) тока (I) как функции разности потенциалов на клеточной мембране (V) в ооцитах Xenopus laevis , инъецированных водой (черные кружки), экспрессирующих ClC- 2 (черные квадраты) или экспрессирующие ClC-2 вместе с конститутивно активным OSR1 T185E (черные треугольники), неактивным OSR1 T185A (белые ромбы) и каталитически неактивным OSR1 D164A (белые квадраты). C: Среднее арифметическое ± SEM (n = 21-25) проводимости, рассчитанной путем линейной аппроксимации I / V-кривых, показанных на B, между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных водой (пунктирная полоса) , экспрессирующие только ClC-2 (белая полоса) или экспрессирующие ClC-2 вместе с конститутивно активным OSR1 T185E (черная полоса), неактивным OSR1 T185A (темно-серая полоса) и каталитически неактивным OSR1 D164A (светло-серая полоса) .* (p <0,05) указывает на статистически значимое отличие от экспрессии только ClC-2.

По крайней мере теоретически, SPAK и OSR1 могли снижать активность канала ClC-2 за счет ускорения извлечения белка канала из клеточной мембраны. Чтобы проверить эту возможность, ооциты Xenopus laevis , экспрессирующие ClC-2 с SPAK или без него, обрабатывали 5 мкМ брефельдином А, веществом, нарушающим встраивание нового канального белка в клеточную мембрану. Как показано на рис.5A, снижение проводимости в присутствии брефельдина A было сходным в ооцитах, экспрессирующих ClC-2 вместе с SPAK, и ооцитах, экспрессирующих только ClC-2. Такие же наблюдения были сделаны на ооцитах Xenopus laevis , экспрессирующих ClC-2 с OSR1 или без него. Как показано на фиг. 5B, снижение проводимости в присутствии брефельдина A снова было сходным в ооцитах, экспрессирующих ClC-2 вместе с OSR1, и в ооцитах, экспрессирующих только ClC-2. Таким образом, ни SPAK, ни OSR1 не ускоряли извлечение канального белка из клеточной мембраны.

Фиг. 5

Эффект брефельдина А на активность канала ClC-2 с коэкспрессией SPAK или OSR1 или без нее. A: Среднее арифметическое ± SEM (n = 18-30) проводимости, рассчитанное путем линейной аппроксимации I / V-кривых между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных только с ClC-2 (ClC-2, белые столбики) или экспрессию ClC-2 вместе со SPAK (черные столбцы) до (левые столбцы, 0 часов) и после (средний и правый столбцы) инкубации с брефельдином А (5 мкМ) в течение 16 или 24 часов.B: Среднее арифметическое ± SEM (n = 16-30) проводимости, рассчитанное путем линейной аппроксимации соответствующих I / V-кривых между -140 мВ и -80 мВ в ооцитах Xenopus laevis , инъецированных только с ClC-2 (ClC-2 , белые столбцы) или экспрессию ClC-2 вместе с OSR1 (черные столбцы) до (левые столбцы, 0ч) и после (средний и правый столбцы) инкубации с брефельдином А (5 мкМ) в течение 16 часов или 24 часов. *** (p <0,001) указывает на статистически значимое отличие от экспрессии только ClC-2. # (p <0,05), ## (p <0.01) и ### (p <0,001) указывают на статистически значимое отличие от отсутствия брефельдина A.

Обсуждение

Настоящее исследование показывает, что WNK-зависимая STE20 / SPS1-связанная пролин / аланин-богатая киназа SPAK и окислительная стресс-чувствительные киназы OSR1 являются мощными негативными регуляторами повсеместно экспрессируемого Cl канала ClC-2. Киназы существенно не изменяют снижение тока после ингибирования встраивания канала в клеточную мембрану, что указывает на то, что киназы не эффективны за счет ускорения клиренса белка канала из клеточной мембраны.Подавление ClC-2 наблюдается после коэкспрессии SPAK и OSR1 дикого типа, а также конститутивно активных SPAK T233E и OSR1 T185E , но не после коэкспрессии нечувствительных к WNK1 неактивных SPAK T233A и OSR1 T185A или каталитически неактивных SPAK D212A или OSR1 D164A . Соответственно, для наблюдаемых эффектов требуется киназная активность.

Эффект SPAK / OSR1 на ClC-2 может участвовать в регуляции объема клетки, поскольку ингибирование каналов Cl препятствует выходу Cl , что приводит к гиперполяризации клеточной мембраны с последующим уменьшением K + выезд.Ингибирование выхода KCl предотвращает дальнейшую потерю осмотически связанной воды. Хорошо известно, что сжатие клеток ингибирует каналы, регулирующие объем клетки, Cl [35,36]. Было показано, что ClC-2 регулируется объемом клеток [32], и понижающая регуляция ClC-2 может вполне участвовать в чувствительной к SPAK / OSR1 регуляции объема клеток.

Cl каналов участвуют в регуляции пролиферации клеток [49]. Активация каналов Cl способствует сокращению клеток, что является предпосылкой для запуска колебаний цитозольной активности Ca 2+ в пролиферирующих клетках [50].

Cl — каналы дополнительно участвуют в регуляции объема клеток во время апоптоза [51,52,53,54,55,56,57,58,59,60,61], а активность ClC-2, чувствительная к SPAK / OSR1, может — по крайней мере теоретически — противодействовать апоптотическому сжатию клеток. ClC-2 Cl каналы особенно влияют на выживаемость мужских половых клеток и фоторецепторов [62].

SPAK / OSR1-чувствительная активность ClC-2 может дополнительно участвовать в регуляции цитозольной активности Cl , потенциала клеточной мембраны и, следовательно, возбудимости нейронов [63].ClC-2 участвует в регуляции легочного хлорида и секреции воды, что является предпосылкой для развития легких плода [64]. Очевидно, что необходимы дальнейшие эксперименты для полного выяснения физиологических функций, зависящих от SPAK / OSR1-чувствительной регуляции ClC-2.

Заключение

SPAK и OSR1 подавляют ClC-2 и, таким образом, вносят вклад в регуляцию этого повсеместно экспрессируемого канала Cl .

Заявление о раскрытии информации

Авторы заявляют, что у них нет конфликта интересов и нечего раскрывать.

Благодарности

Авторы выражают признательность Сари Рюбе за тщательную подготовку рукописи и техническую поддержку Эльфриде Фабер. Это исследование было поддержано Deutsche Forschungsgemeinschaft, GRK 1302, SFB 773 B4 / A1, La 315 / 13-3 и Фондом публикаций открытого доступа Тюбингенского университета.

Список литературы

  1. Rafiqi FH, Zuber AM, Glover M, Richardson C, Fleming S, Jovanovic S, Jovanovic A, O’Shaughnessy KM, Alessi DR: Роль активируемой WNK киназы SPAK в регулировании артериального давления.EMBO Mol.Med. 2010; 2: 63-75.
  2. Castaneda-Bueno M, Gamba G: SPAKling понимание регуляции артериального давления. EMBO Mol Med 2010; 2: 39-41.
  3. Yang SS, Lo YF, Wu CC, Lin SW, Yeh CJ, Chu P, Sytwu HK, Uchida S, Sasaki S, Lin SH: у мышей с нокаутом SPAK проявляется синдром Гительмана и нарушение вазоконстрикции.J Am Soc Nephrol 2010; 21: 1868-1877.
  4. Lin SH, Yu IS, Jiang ST, Lin SW, Chu P, Chen A, Sytwu HK, Sohara E, Uchida S, Sasaki S, Yang SS: Нарушение фосфорилирования Na (+) — K (+) — 2Cl (-) Котранспортер из-за дефицита киназы-1, чувствительной к окислительному стрессу, проявляется гипотонией и синдромом Барттера.Proc Natl Acad Sci USA 2011; 108: 17538-17543.
  5. Villa F, Deak M, Alessi DR, van Aalten DM: Структура киназы OSR1, мишени для лекарства от гипертонии. Белки 2008; 73: 1082-1087.
  6. Vitari AC, Thastrup J, Rafiqi FH, Deak M, Morrice NA, Karlsson HK, Alessi DR: Функциональные взаимодействия киназ SPAK / OSR1 с их вышестоящим активатором WNK1 и нижележащим субстратом NKCC1.Biochem J 2006; 397: 223-231.
  7. Гловер М., Зубер А.М., О’Шонесси К.М.: Гипертония, диетическое потребление соли и роль тиазид-чувствительного переносчика хлорида натрия NCCT. Cardiovasc Ther 2011; 29: 68-76.
  8. O’Reilly M, Marshall E, Speirs HJ, Brown RW: WNK1, ген в новом пути контроля артериального давления, тканеспецифично генерирует радикально разные изоформы с киназным доменом и без него.J Am Soc Nephrol 2003; 14: 2447-2456.
  9. Vitari AC, Deak M, Morrice NA, Alessi DR: протеинкиназы WNK1 и WNK4, которые мутировали при синдроме гипертонии Гордона, фосфорилируют и активируют протеинкиназы SPAK и OSR1. Biochem J 2005; 391: 17-24.
  10. Kahle KT, Rinehart J, Lifton RP: Фосфорегуляция котранспортеров Na-K-2Cl и K-Cl киназами WNK.Biochim Biophys Acta 2010; 1802: 1150-1158.
  11. Flatman PW: Котранспортеры, WNK и гипертония: обновление. Curr Opin Nephrol Hypertens 2008; 17: 186-192.
  12. Furgeson SB, Linas S: Механизмы псевдогипоальдостеронизма типа I и типа II.J Am Soc Nephrol 2010; 21: 1842-1845.
  13. Uchida S: Патофизиологические роли киназ WNK в почках. Pflugers Arch 2010; 460: 695-702.
  14. Уилсон Ф.Х., Диссе-Никодем С., Чоат К.А., Ишикава К., Нельсон-Уильямс С., Деситтер I, Гюнель М., Милфорд Д.В., Липкин Г.В., Ахард Дж.М., Фили М.П., ​​Дассол Б., Берланд И., Анвин Р.Дж., Майан Х, Саймон DB, Farfel Z, Jeunemaitre X, Lifton RP: Человеческая гипертензия, вызванная мутациями киназ WNK.Наука 2001; 293: 1107-1112.
  15. Achard JM, Disse-Nicodeme S, Fiquet-Kempf B, Jeunemaitre X: Фенотипическая и генетическая гетерогенность семейной гиперкалиемической гипертензии (синдром Гордона). Clin Exp Pharmacol Physiol 2001; 28: 1048-1052.
  16. Capasso G, Cantone A, Evangelista C, Zacchia M, Trepiccione F, Acone D, Rizzo M: каналы, носители и насосы в патогенезе натрий-чувствительной гипертензии.Семин Нефрол 2005; 25: 419-424.
  17. Delpire E, Gagnon KB: SPAK и OSR1, ключевые киназы, участвующие в регуляции транспорта хлоридов. Acta Physiol (Oxf) 2006; 187: 103-113.
  18. Delpire E, Gagnon KB: SPAK и OSR1: STE20 киназы, участвующие в регуляции ионного гомеостаза и контроле объема в клетках млекопитающих.Biochem J 2008; 409: 321-331.
  19. Гименес I: Молекулярные механизмы и регуляция фуросемид-чувствительных котранспортеров Na-K-Cl. Curr Opin Nephrol Hypertens 2006; 15: 517-523.
  20. Ричардсон С., Сакамото К., де лос HP, Деак М., Кэмпбелл Д.Г., Прескотт А.Р., Алесси Д.Р.: Регулирование котранспортера ионов NKCC2 с помощью SPAK-OSR1-зависимых и -независимых путей.J Cell Sci 2011; 124: 789-800.
  21. Gagnon KB, Delpire E: О распознавании субстрата и негативной регуляции SPAK, киназы, модулирующей активность Na + -K + -2Cl-. Am J Physiol Cell Physiol 2010; 299: C614-C620.
  22. Гловер М., О’Шонесси К.М.: киназы SPAK и WNK: новая мишень для лечения артериального давления? Curr Opin Nephrol Hypertens 2011; 20: 16-22.
  23. Хуанг С.Л., Ян С.С., Линь С.Х.: Механизм регуляции почечного транспорта ионов с помощью киназ WNK. Curr Opin Nephrol Hypertens 2008; 17: 519-525.
  24. Mercier-Zuber A, O’Shaughnessy KM: Роль передачи сигналов SPAK и OSR1 в регуляции котранспортеров NaCl.Curr Opin Nephrol Hypertens 2011; 20: 534-540.
  25. Ричардсон С., Алесси Д.Р.: Регулирование транспорта соли и артериального давления с помощью сигнального пути WNK-SPAK / OSR1. J Cell Sci 2008; 121: 3293-3304.
  26. Pasham V, Pathare G, Fajol A, Rexhepaj R, Michael D, Pakladok T., Alesutan I, Rotte A, Foller M, Lang F: OSR1-чувствительный транспорт Na + в тонком кишечнике.Am J Physiol Gastrointest Liver Physiol 2012; 303: G1212-1219.
  27. Патхаре Г., Фоллер М., Дарьядел А., Мутиг К., Богатиков Е., Фаджол А., Алмиладжи А., Майкл Д., Штанге Дж., Воелкл Дж., Вагнер С.А., Бахманн С., Ланг Ф: OSR1-чувствительная реабсорбция канальцевого фосфата в почках. Kidney Blood Press Res 2012; 36: 149-161.
  28. Pathare G, Foller M, Michael D, Walker B, Hierlmeier M, Mannheim JG, Pichler BJ, Lang F: Повышенные концентрации FGF23 в сыворотке и фосфатурия у мышей, нацеленных на гены, экспрессирующих WNK-устойчивый Spak. Kidney Blood Press Res 2012; 36: 355-364.
  29. Пашам В., Ротте А., Ян В. Т., Зеленак С., Бхандару М., Фоллер М., Ланг Ф: OSR1-чувствительная регуляция активности обменника Na + / H + в дендритных клетках.Am J Physiol Cell Physiol 2012; 303: C416-C426.
  30. Delpire E, Austin TM: Киназная регуляция котранспорта Na + -K + -2Cl- в первичных афферентных нейронах. J. Physiol 2010; 588: 3365-3373.
  31. Фурукава Т., Огура Т., Катаяма Ю., Хираока М.: Характеристики тока ClC-2 кролика, выраженного в ооцитах Xenopus, и его вклад в регуляцию объема.Am J Physiol 1998; 274: C500-512.
  32. Grunder S, Thiemann A, Pusch M, Jentsch TJ: Области, участвующие в открытии хлоридного канала CIC-2 по напряжению и объему ячейки. Nature 1992; 360: 759-762.
  33. Thiemann A, Grunder S, Pusch M, Jentsch TJ: хлоридный канал, широко экспрессируемый в эпителиальных и неэпителиальных клетках.Nature 1992; 356: 57-60.
  34. Jentsch TJ, Gunther W, Pusch M, Schwappach B: Свойства потенциал-управляемых хлоридных каналов семейства генов ClC. J. Physiol 1995; 482: 19S-25S.
  35. Lang F, Busch GL, Volkl H: Разнообразие механизмов регулирования объема.Cell Physiol Biochem 1998; 8: 1-45.
  36. Macri P, Breton S, Marsolais M, Lapointe J, Laprade R: Гипертонус снижает базолатеральную проводимость K + и Cl- в проксимальных извитых канальцах кролика. J. Membr Biol 1997; 155: 229-237.
  37. Pusch M, Jordt SE, Stein V, Jentsch TJ: Хлоридная зависимость ворот хлоридных каналов, активируемых гиперполяризацией.J. Physiol 1999; 515: 341-353.
  38. Стеген С, Мацкевич И., Вагнер К.А., Паульмихл М., Ланг Ф, Броер С.: Вызванное набуханием высвобождение таурина без активности хлоридных каналов в ооцитах Xenopus laevis, экспрессирующих анионные каналы и переносчики. Biochim Biophys Acta 2000; 1467: 91-100.
  39. Пакладок Т., Алмиладжи А., Муньос С., Алесутан I, Ланг F: PIKfyve чувствительность каналов hERG.Cell Physiol Biochem 2013; 31: 785-794.
  40. Mia S, Munoz C, Pakladok T, Siraskar G, Voelkl J, Alesutan I, Lang F: Подавление Kv1.5K каналов с помощью AMP-активированной протеинкиназы. Cell Physiol Biochem 2012; 30: 1039-1050.
  41. Хенрион У., Цумхаген С., Стейнке К., Струц-Сибом Н., Столлмейер Б., Ланг Ф., Шульце-Бар Э., Сибом Г.: перекрывающийся сердечный фенотип, связанный с семейной мутацией в датчике напряжения канала KCNQ1.Cell Physiol Biochem 2012; 29: 809-818.
  42. Хоссейнзаде З., Бхавсар С.К., Ланг Ф: Подавление ClC-2 с помощью JAK2. Cell Physiol Biochem 2012; 29: 737-742.
  43. Alesutan I, Sopjani M, Dermaku-Sopjani M, Munoz C, Voelkl J, Lang F: Повышение регуляции Na-связанного переносчика глюкозы SGLT1 с помощью тау-тубулинкиназы 2.Cell Physiol Biochem 2012; 30: 458-465.
  44. Хоссейнзаде З., Донг Л., Бхавсар С.К., Варси Дж., Алмиладжи А., Ланг Ф .: Повышающая регуляция пептидных транспортеров PEPT1 и PEPT2 с помощью киназы Janus JAK2. Cell Physiol Biochem 2013; 31: 673-682.
  45. Almilaji A, Munoz C, Hosseinzadeh Z, Lang F: Повышающая регуляция Na +, Cl (-) — переносчика бетаина / гамма-аминомасляной кислоты BGT1 с помощью тау-тубулинкиназы 2.Cell Physiol Biochem 2013; 32: 334-343.
  46. Богатиков Е., Муньос С., Пакладок Т., Алесутан I, Шоджаифард М., Сибом Г., Фоллер М., Пальмада М., Бомер С., Броер С., Ланг F: Повышение активности переносчика аминокислот SLC6A19 и обилия поверхностных белков с помощью PKB / Akt и ПИКфыве. Cell Physiol Biochem 2012; 30: 1538-1546.
  47. Almilaji A, Szteyn K, Fein E, Pakladok T, Munoz C, Elvira B, Towhid ST, Alesutan I, Shumilina E, Bock CT, Kandolf R, Lang F: подавление активности Na / K + -атпазы капсидом парвовируса B19 человека белок VP1. Cell Physiol Biochem 2013; 31: 638-648.
  48. Dermaku-Sopjani M, Almilaji A, Pakladok T, Munoz C, Hosseinzadeh Z, Blecua M, Sopjani M, Lang F: подавление Na-связанного транспортера фосфата NaPi-IIa с помощью AMP-активированной протеинкиназы.Kidney Blood Press Res 2013; 37: 547-556.
  49. Ланг Ф., Фоллер М., Ланг К., Ланг П., Риттер М., Веренинов А., Сабо И., Хубер С. М., Гулбинс Е.: ионные каналы, регулирующие объем клетки, при пролиферации и гибели клеток. Методы Enzymol 2007; 428: 209-225.
  50. Ritter M, Woll E, Waldegger S, Haussinger D, Lang HJ, Scholz W., Scholkens B, Lang F: сокращение клеток стимулирует индуцированные брадикинином колебания потенциала клеточной мембраны в фибробластах NIH 3T3, экспрессирующих ras-онкоген.Арка Пфлюгерса 1993; 423: 221-224.
  51. Элиндер Ф., Аканда Н., Тофиги Р., Шимицу С., Цудзимото Ю., Оррениус С., Цеккателли С. Открытие потенциал-зависимых анионных каналов плазматической мембраны (VDAC) предшествует активации каспазы при апоптозе нейронов, вызванном токсическими стимулами. Cell Death Differ 2005; 12: 1134-1140.
  52. Lang F, Shumilina E, Ritter M, Gulbins E, Vereninov A, Huber SM: Ионные каналы и объем клеток в регуляции пролиферации клеток и апоптической гибели клеток. Contrib Nephrol 2006; 152: 142-160.
  53. Myssina S, Lang PA, Kempe DS, Kaiser S, Huber SM, Wieder T., Lang F: блокаторы Cl-каналов NPPB и нифлумовая кислота притупляют Ca (2 +) — индуцированный апоптоз эритроцитов.Cell Physiol Biochem 2004; 14: 241-248.
  54. Окада Y, Maeno E: Апоптоз, регулирование объема клеток и хлоридные каналы, регулирующие объем. Comp Biochem Physiol A Mol Integr Physiol 2001; 130: 377-383.
  55. Окада Ю., Маэно Э., Симидзу Т., Манабе К., Мори С., Набекура Т.: Двойная роль хлоридных каналов плазмалеммы в индукции гибели клеток.Арка Пфлюгерса 2004; 448: 287-295.
  56. Porcelli AM, Ghelli A, Zanna C, Valente P, Ferroni S, Rugolo M: апоптоз, индуцированный стауроспорином в клетках ECV304, требует сокращения клеток и усиления проводимости Cl-. Cell Death Differ 2004; 11: 655-662.
  57. Симидзу Т., Нумата Т., Окада Ю.: Роль активных форм кислорода в апоптотической активации объемно-чувствительного канала Cl (-).Proc Natl Acad Sci USA 2004; 101: 6770-6773.
  58. Souktani R, Berdeaux A, Ghaleh B, Giudicelli JF, Guize L, Le Heuzey JY, Henry P: Индукция апоптоза с помощью сфинголипидов активирует хлоридный ток в ооцитах Xenopus laevis. Am J Physiol Cell Physiol 2000; 279: C158-C165.
  59. Szabo I, Lepple-Wienhues A, Kaba KN, Zoratti M, Gulbins E, Lang F: Зависимая от тирозинкиназа активация хлоридного канала в CD95-индуцированном апоптозе Т-лимфоцитов.Proc Natl Acad Sci USA 1998; 95: 6169-6174.
  60. Wei L, Xiao AY, Jin C, Yang A, Lu ZY, Yu SP: Влияние блокаторов хлоридных и калиевых каналов на апоптотическое сокращение клеток и апоптоз в корковых нейронах. Арка Пфлюгерса 2004; 448: 325-334.
  61. Zuo W, Zhu L, Bai Z, Zhang H, Mao J, Chen L, Wang L: Хлоридные каналы участвуют в индуцированном перекисью водорода апоптозе клеток PC12.Biochem Biophys Res Commun 2009; 387: 666-670.
  62. Bosl MR, Stein V, Hubner C, Zdebik AA, Jordt SE, Mukhopadhyay AK, Davidoff MS, Holstein AF, Jentsch TJ: мужские половые клетки и фоторецепторы, оба зависят от тесных межклеточных взаимодействий, дегенерируют на ClC-2 Cl (- ) нарушение канала.EMBO J 2001; 20: 1289-1299.
  63. Стейли К., Смит Р., Шаак Дж., Уилкокс С., Джентч Т.Дж .: Изменение функции рецептора ГАМКА после переноса гена хлоридного канала CLC-2. Нейрон 1996; 17: 543-551.
  64. Blaisdell CJ, Edmonds RD, Wang XT, Guggino S, Zeitlin PL: pH-регулируемая секреция хлорида в эпителии легких плода.Am J Physiol Lung Cell Mol Physiol 2000; 278: L1248-1255.

Автор Контакты

Проф. Д-р Флориан Ланг

Кафедра физиологии Тюбингенского университета

Gmelinstr. 5, D-72076 Тюбинген (Германия)

Тел. +49 7071/2972194, факс +49 7071/2

, электронная почта [email protected]


Подробности статьи / публикации

Предварительный просмотр первой страницы

Принята к печати: 23 июля 2014 г.
Опубликована онлайн: 14 октября 2014 г.
Дата выпуска: ноябрь 2014 г.

Количество страниц для печати: 10
Количество рисунков: 0
Количество столов: 0

ISSN: 1420-4096 (печатный)
eISSN: 1423-0143 (онлайн)

Для дополнительной информации: https: // www.karger.com/KBR


Лицензия открытого доступа / Дозировка лекарства / Заявление об ограничении ответственности

Лицензия открытого доступа: это статья в открытом доступе под лицензией Creative Commons Attribution-NonCommercial 3.0 Unported (CC BY-NC) (www.karger.com/OA-license), применимой к онлайн-версии только статья. Распространение разрешено только в некоммерческих целях.
Дозировка лекарственного средства: авторы и издатель приложили все усилия для обеспечения того, чтобы выбор и дозировка лекарств, указанные в этом тексте, соответствовали текущим рекомендациям и практике на момент публикации.Тем не менее, ввиду продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным средством является новое и / или редко применяемое лекарство.
Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.Появление в публикации рекламы и / или ссылок на продукты не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор (-ы) не несут ответственности за любой ущерб, нанесенный людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в контенте или рекламе.

Обзор жилищного плана | AustinTexas.gov

Подразделение по пересмотру жилищного плана рассматривает новое строительство, пристройки, внутреннюю реконструкцию и снос односемейных, дуплексных или двухквартирных домов и / или дополнительных построек на одном участке.Проекты жилищного строительства проверяются на соответствие положениям , глава 25-2, Кодекса землеустройства, Международному жилищному кодексу 2015 г.


Задержка обработки приема

Из-за необычно большого объема ответы и обработка заявок в настоящее время занимают примерно на 10 рабочих дней больше, чем на запланированные сроки обслуживания клиентов.

НОВЫЙ процесс подачи заявления на проживание

Заявки на получение разрешения на проживание, изменения и обновления теперь можно подавать с помощью онлайн-формы:

Форма запроса на прием жилья

Этот новый инструмент подачи заявок является пилотным.Отзыв об этом новом процессе отправки можно отправить здесь.

Если у вас есть быстрый вопрос или вам нужна дополнительная информация, попробуйте функцию чата в правом нижнем углу этой страницы. Персонал программы Residential Plan, использующий чат, может помочь вам:

  • Определите, требуется ли пересмотр плана для вашего проекта
  • Узнайте, чего ожидать в процессе проверки плана
  • Знайте, что нужно для подачи заявки
  • Свяжите свой проект со своей учетной записью Austin Build + Connect (AB + C)

Чат доступен 7:45 a.м. — 16:45, с понедельника по пятницу.


Услуги, предоставляемые Residential Plan Review

Обзор предварительного плана

Предварительная проверка плана позволяет владельцу или агенту (агентам) встретиться с рецензентами плана для обсуждения вопросов предварительного проектирования или кода.

Эти встречи предназначены для определения вопросов, которые необходимо решить или изменить до того, как планы строительства будут представлены городским властям для рассмотрения в разрешении.

Все PPR координируются Программой ускоренной проверки плана строительства.Цены на PPR варьируются в зависимости от участвующих дисциплин и количества требуемых дисциплин. Сборы взимаются в соответствии с почасовой ставкой каждой дисциплины. Посетите веб-сайт ускоренной проверки, чтобы получить полный список сборов по дисциплинам проверки.

Форма запроса на пересмотр предварительного плана (PDF)

Экспресс-разрешение

Экспресс-разрешение предлагается на второстепенные объемы работ для жилой недвижимости.

  • Замена окон (размер на размер)
  • Замена входных дверей (размер на размер)
  • Добавление / снятие сайдинга
  • Добавление / удаление кирпича
  • Добавление / снятие изоляции
  • Ремонт кровли в части замены настилов
  • Ремонт фундамента без увеличения непроницаемой оболочки
  • Ремонт ванной комнаты (преобразование ванны / душа) и реконструкция кухни
    • Снимается только гипсокартон по периметру ванны / душа / раковины
    • Стены нельзя переместить или удалить
    • Сантехника не может быть перемещена или добавлена ​​
  • Внутреннее неструктурное исследование
    • Снимайте гипсокартон / изоляцию только для осмотра конструкции или оценки
    • Детекторы дыма и сигнализация должны соответствовать коду
  • Только ремонт гипсокартона
    • Ремонт свыше 64 кв.фут
    • Детекторы дыма и сигнализаторы угарного газа должны соответствовать требованиям кодекса

Заявление на получение срочного разрешения на проживание (PDF)

Малые проекты

Следующие типы приложений квалифицируются как малый проект:

Счет за

малых проектов будет выставлен по ставке рассмотрения плана малых проектов в соответствии с утвержденным графиком сборов:
Проверка плана жилого строительства и сборы за разрешение (PDF)

Если объем проекта превышает объем небольшого проекта (ов), необходимо отозвать обзор плана (PR) и повторно представить проект, используя заявку на получение разрешения на новое строительство и пристройку:

Жилое строительство и пристройка (PDF)
Интерактивное руководство по заявке на строительство и пристройку жилых домов

Сборы за рассмотрение небольшого проекта не будут возвращены в соответствии с графиком сборов или применяться к новой заявке на разрешение.

Новое строительство / Дополнение / Реконструкция

Проекты, которые выходят за рамки срочного разрешения или небольшой проект, будут рассмотрены в соответствии со сроками проверки жилого фонда. В приведенной ниже таблице отражены новые сроки проверки, которые вступили в силу 16 мая 2017 г. Эти сроки проверки будут пересматриваться ежегодно, начиная с 2018 финансового года, и могут корректироваться в зависимости от наличия дополнительных ресурсов, наличия дополнительных требований кодекса без дополнительные ресурсы или сокращение застройки в городе Остин.

Время проверки опубликовано в Разделе 15.7 Руководства по критериям строительства и включает время проверки, указанное ниже:

ОБЗОР ЖИЛОГО ПЛАНА ТИП ВРЕМЯ ПРОСМОТРА
( рабочих дней )
Новое строительство и пристройки 15
Ремонт интерьера 5
Заявки на обновление и исправления соответствует времени рассмотрения исходной заявки
Экспресс Обычно в тот же день
Снос 5
Переезд 5
С.M.A.R.T. Дом 5
Новая конструкция, основной набор Volume Builder *
Действует с 1 октября 2017 г.
10
Новое строительство, участник Volume Builder с утвержденным основным набором * 5

* Время проверки приложения Volume Builder возвращается к времени проверки нового строительства, когда требуется дополнительная группа проверки, такая как проверка дерева или огня. Основные наборы предназначены только для зонирования и технической проверки, так как другие проверки выполняются во время разбиения на части, плана участка или формальной проверки.

Разрешение на домовладение

Лицо может получить разрешение домовладельца (приусадебного участка) лично в сервисном центре DSD (ранее известном как Центр разрешений), если оно соответствует требованиям для участия:

Разрешение на домовладение (PDF)

Требуется аффидевит усадьбы:

Аффидевит усадьбы (PDF)

Отправьте онлайн, заполнив форму запроса сервисного центра.

Программа Volume Builder

Строительная компания — это строитель, строящий не менее 5 единиц жилья на одну или две семьи на участках в пределах одного подразделения, в одном комплексе таунхаусов или на многосемейном зонированном участке с домами на одну или две семьи.

Подразделение должно иметь минимум 10 лотов, за исключением измененных площадок, уже включенных в программу. Административные отказы будут рассматриваться в индивидуальном порядке, если застройщик не соответствует требованиям. Узнайте больше о программе Volume Builder.

Требования к сносу / перемещению

Заявления о перемещении и сносе отправляются в Управление по сохранению исторического наследия для проверки исторической применимости, если строению 45 лет или старше

Процессы и требования

Работа без разрешения

Для некоторых видов работ разрешение не требуется.Пожалуйста, обратитесь к разделу Work Exempt для каждого принятого кода из списка. Работа, на которую не выдано разрешение, должна соответствовать действующим Строительным нормам и правилам, городским нормам и всем другим применимым постановлениям.

Программа сертификата соответствия
Самостоятельная сертификация

для сертифицированных проектировщиков зданий и архитекторов, имеющих лицензию Техас, предлагается для некоторых соответствующих проектов.
Подробнее о программе сертификатов соответствия

Процесс выдачи разрешений
  1. Предварительная встреча .Если владелец и / или его агенты желают встретиться с персоналом для обсуждения вопросов предварительного проектирования и / или строительства, запросите встречу по рассмотрению предварительного плана (PPR) в любое время до подачи заявки на разрешение на рассмотрение жилищного плана. Эти встречи, проводимые группой ускоренной проверки плана строительства, предназначены для оказания помощи владельцу и / или группе проектировщиков в выявлении вопросов, которые необходимо решить или изменить, прежде чем планы строительства будут представлены в город на рассмотрение. PPR не гарантирует утверждения планов.Встреча по предварительному рассмотрению плана требуется для любой общей консультации перед подачей заявки, которая требует более 20 минут.
    Форма запроса на пересмотр предварительного плана (PDF)
  2. Подготовьтесь. Загрузите соответствующее заявление и просмотрите контрольные списки, чтобы определить, какую документацию вам необходимо собрать для подачи заявления на разрешение. Просмотр жилых домов Проверьте заявки и контрольные списки.
  3. Разрешения с истекшим сроком действия . Все разрешения с истекшим сроком действия (разрешения на строительство и разрешения на торговлю (BP, MP, EP, PP) должны быть решены. Щелкните здесь, чтобы просмотреть историю разрешений (заполните поля «Поиск по собственности» и диапазон дат.)
  4. Подайте заявку с формой запроса на прием в жилую недвижимость — После того, как ваш проект будет принят на рассмотрение, вы получите счет и ссылку для загрузки всех необходимых документов и чертежей, указанных в заявке. Счет можно оплатить на портале AB + C. После оплаты счета ваш проект будет передан на рассмотрение, и начнется ваше время проверки.
  5. Обзор плана .Проверяйте, чтобы сотрудники проверяли планы в порядке их получения и в соответствии с установленным сроком проверки. После завершения проверки вы получите уведомление об одобрении или основной отчет с комментариями по электронной почте, которые должны быть адресованы владельцем или агентом владельца до утверждения заявки на разрешение.
  6. Отправьте любые исправления (обновления) в форму заявки на прием жилого помещения . Внесите исправления в необходимую документацию, как указано в Основном отчете с комментариями. Если у вас есть вопросы по поводу комментариев, обратитесь к назначенному рецензенту за разъяснениями, и они ответят на ваше письмо или позвонят в течение 24 часов.Если вам нужно больше 20 минут или вам нужно встретиться с более чем одним предметом рассмотрения, запланируйте консультацию по пересмотру плана, связавшись напрямую со своим рецензентом. Рецензент-координатор рассмотрит ваш запрос и выставит счет. Как только ваше обновление будет принято на рассмотрение, вы получите счет (если применимо) и ссылку для загрузки обновленных документов и чертежей. Обратите внимание, что при отправке обновления необходимо отправить полный набор планов, а не только обновленные листы. Счет можно оплатить на портале AB + C.Возможно, вам придется повторить этот шаг, если недостатки останутся.
  7. Выдача разрешения . После того, как последний рецензент одобрит вашу заявку, планы возвращаются нашему координирующему рецензенту, который завершает процесс. Этот шаг может занять от одного до двух дней. После создания необходимых разрешений вы получите электронное письмо с указанием, что разрешения ожидают активации. Для активации разрешений воспользуйтесь формой запроса сервисного центра.
  8. Инспекции .После активации разрешений вы можете назначить встречу перед началом строительства, а затем начать строительство и процесс проверки.
    Строительная инспекция
  9. Отправьте любые изменения с формой запроса на прием жилого помещения . Мы понимаем, что изменения могут происходить в этой области по разным причинам. Или вы могли отложить отправку некоторых элементов, как это разрешено кодом.
Требования к чертежам

Требования к чертежам зависят от объема работ и объема вашего проекта, и их можно найти в разделе «Формы и приложения» ниже.

Время просмотра

В приведенной ниже таблице отражены новые сроки проверки, которые вступили в силу 16 мая 2017 года.

Эти сроки проверки будут пересматриваться ежегодно, начиная с 2018 финансового года, и могут корректироваться в зависимости от наличия дополнительных ресурсов, наличия дополнительных требований кодекса без дополнительных ресурсов или снижения уровня развития в городе Остин.

Время проверки опубликовано в Разделе 15.7 Руководства по критериям строительства и включает время проверки, указанное ниже:

ОБЗОР ЖИЛОГО ПЛАНА ТИП ВРЕМЯ ПРОСМОТРА
( рабочих дней )
Новое строительство и пристройки 15
Ремонт интерьера 5
Заявки на обновление и исправления соответствует времени рассмотрения исходной заявки
Экспресс Обычно в тот же день
Снос 5
Переезд 5
С.M.A.R.T. Дом 5
Новая конструкция, основной набор Volume Builder *
Действует с 1 октября 2017 г.
10
Новое строительство, участник Volume Builder с утвержденным основным набором * 5

* Время проверки приложения Volume Builder возвращается к времени проверки нового строительства, когда требуется дополнительная группа проверки, такая как проверка дерева или огня. Основные наборы предназначены только для зонирования и технической проверки, так как другие проверки выполняются во время разбиения на части, плана участка или формальной проверки.

Статус проекта

Статус вашей заявки можно проверить онлайн через портал Austin Build + Connect (AB + C).

Комиссии

Стоимость проекта зависит от объема работ. Обратите внимание, что сборы за разрешение не связаны с сборами за подачу заявления на разрешение.

Пересмотр плана жилого дома и сборы за разрешение (PDF)

Редакции

Требуются изменения для внесения изменений в разрешения на строительство; для добавления или удаления разрешения на торговлю; а также для изменений утвержденного проекта после утверждения заявки на получение разрешения и создания разрешений и до того, как конструкция прошла окончательную проверку.Отправьте любые изменения вместе с формой запроса на зачисление в жилой дом.

Отдельные разрешения на торговлю

Большинство автономных торговых разрешений можно запросить непосредственно через портал AB + C. Если у вас есть какие-либо вопросы или проблемы, посетите страницу сервисного центра.

Дополнительные проверки, которые могут потребоваться

Посещаемость

Строительство нового жилого дома с жилой площадью на первом этаже должно соответствовать Постановлению о посещаемости

Пример плана посещаемости (PDF)

Зонирование и перекрытия

Проверьте зонирование, чтобы определить, входит ли собственность в район зонирования, допускающий такое использование.

Зонирование и перекрытия

Соответствие Постановлению о деревьях

Посмотреть требования к подаче и инструкции по подаче заявки

Соответствие постановлениям о деревьях

Subdivision Plat / Legal Статус лота

Если проект находится на участке земли, который не входит в состав участка, зарегистрированного в городском управлении Остина, заявитель будет направлен в Центр содействия развитию , чтобы определить, соответствует ли проект критериям исключения для строительства.

Близость поймы

Проекты в пределах 100 футов от 100-летней поймы потребуют дополнительной проверки поймы.

Близость поймы

Зона опасности эрозии

Проверка зоны опасности эрозии требуется всякий раз, когда объект находится в пределах 100 футов от осевой линии русла ручья / ручья.

Зона опасности эрозии

Сортировка и осушение

Проверка профилирования и дренажа необходима, когда ливневый водозабор находится в пределах 10 футов от выемки на подъездной дороге.

Сортировка и осушение

Краны для водоснабжения Austin

Водопроводный кран Остина необходим всякий раз, когда к дому добавляется новый кран.

Водопроводные краны Austin

Местные очистные сооружения (OSSF)

Проверка OSSF необходима всякий раз, когда в собственности есть септическая система и кондиционируемое пространство добавляется к собственности, добавляются спальни, увеличивается площадь застройки собственности (добавление бассейна, патио, гаража и т. Д.).

Собственная канализация (OSSF)

Противопожарная

Проверка на пожаротушение необходима, когда общая площадь конструкции под крышей превышает 3600 SF, объект расположен в пределах 200 футов от опасного трубопровода или когда владелец собственности хочет установить спринклерную систему независимо от требований норм.

Противопожарная

Историческая применимость

Любые постройки возрастом 45 лет и старше будут отправлены на рассмотрение в Управление охраны памятников старины.Объекты, которые являются историческими зонами или находятся в историческом районе, также будут отправлены на рассмотрение в Управление по сохранению исторического наследия.

Историческая применимость


Новые процедуры или требования

  • Частные ограничительные соглашения, законы о городском зонировании и заявления на получение городских разрешений
  • Плата за консультацию
    Хотя это не новая плата, необходимо внести ясность в ее администрирование. Плата за консультацию будет использована, когда сотрудники проводят дополнительное время с заявителем, чтобы помочь им в утверждении их заявки на разрешение.О добавлении этого сбора будет сообщено заявителю до его добавления в проект, и он применим только к проектам, которые находятся в процессе рассмотрения.

Формы и приложения

Руководство по заявкам на пересмотр жилищного плана

Руководство по подаче заявления на зонирование жилых помещений (PDF)

В этом руководстве приведены пошаговые инструкции по заполнению заявления на получение разрешения на новое строительство и пристройку.Эту информацию также можно использовать для заполнения всех других заявлений на получение разрешения на проживание. Пожалуйста, ознакомьтесь с этим документом при заполнении заявки на разрешение.

Заявления о пересмотре жилого плана

Заполните форму заявки на прием квартирного жилья

Дополнительные формы для проверки жилого плана

Помощь при пересмотре жилищного плана
Контрольные списки проверки жилого плана (для справки)
Контрольные списки для проверки жилых помещений (для справки)

Часто задаваемые вопросы

Что такое неудачи?

Неудачи — это область собственности, которая должна оставаться свободной и открытой для неба наверху.Ограниченные элементы могут быть построены в случае неудачи и описаны в разделе LDC 25-2-513. [BS1]

Однако другие классификации жилого зонирования имеют другие недостатки. Обратитесь к разделу LDC 25-2-492, чтобы узнать о возможных отклонениях по классификации зонирования.

Что может посягнуть на неудачу?

Ограниченные предметы могут быть спроектированы или построены в условиях неудачи. Эти надбавки описаны в разделе 25-2-513 Кодекса землеустройства города Остин. Обратите внимание, что механические агрегаты и оборудование для бассейнов допускаются в обязательном отступлении во дворе.

Что такое коэффициент площади пола (FAR)?

FAR — это отношение площади помещения к размеру лота. Он определяет, сколько строительной площади можно построить на определенных объектах недвижимости.

Могу ли я сделать перепланировку интерьера с переоборудованием гаража?

Ответ — да. Однако вам необходимо будет заполнить заявку на реконструкцию жилого интерьера и заявку на переоборудование гаража и навес для машины / крыльца. Для обоих приложений будет использоваться один и тот же набор чертежей; нет необходимости дублировать необходимые копии документов.Мы создадим одну папку для просмотра обоих приложений. Оба они будут считаться небольшими проектами, и для каждого из них будет взиматься небольшая плата за рассмотрение плана. В нашей базе данных будет создана только одна папка обзора плана (PR), и только один набор разрешений будет создан для обоих приложений. Время рассмотрения будет соответствовать времени рассмотрения типа заявки с наибольшим временем рассмотрения. Актуальную информацию о стоимости проверки и времени проверки можно найти на нашем веб-сайте.

Сколько сторон навеса можно закрыть стенами?

Навесы для автомобилей должны быть открытыми не менее чем с двух сторон.Навесы для автомобилей, не открывающиеся с двух или более сторон, считаются гаражом и должны соответствовать требованиям правил для гаражей. Раздел ссылочного кода: 2015 IRC R309.2 Навесы для автомобилей.

Считается ли подъем крыши в моем доме ремонтом интерьера?

Подъем крыши дома считается дополнением. При подъеме крыши дома необходимо подать Заявку на строительство и достройку жилого дома. Если дом расположен на плане участка в режиме кондоминиума, необходимо подать заявление на получение разрешения на строительство нового кондоминиума и может потребоваться освобождение от плана участка.Проконсультируйтесь с Центром помощи развитию (DAC), если ваш дом расположен в плане участка в режиме кондоминиума, чтобы узнать, требуется ли для вашей работы освобождение от плана строительства.

Нужно ли разрешение на постройку колоды менее 200 кв. Футов на участке, не прилегающем к жилому помещению, и высотой менее 30 дюймов над землей?

Палуба с таким описанием не требуется для подачи заявки на разрешение на строительство, если она не находится в зоне опасности наводнения. Раздел ссылочного кода: R105.2 Работа без разрешения , Местные поправки к Международному жилищному кодексу 2015 г. Имейте в виду, что работа, на которую не выдано разрешение, должна по-прежнему соответствовать Жилищному кодексу и всем другим применимым законам и требованиям Городского кодекса.

Когда мне нужен отчет о структурной проверке?

Нам требуются планы фундамента, планы ветровых ограждений и планы каркаса для нового строительства. Тем не менее, мы разрешаем отчет о структурной проверке вместо структурных чертежей для следующих типов проектов:

Преобразование навеса для машины с существующим фундаментом, открытым не более чем с двух сторон, в одноэтажное жилое пространство Перестройка интерьера, при котором не предполагается никаких дополнений к зданию

Раздел справочного кода: Руководство по критериям строительства (BCM) 4.4.4.6.

  • Изменения в использовании с реконструкцией только в том случае, если никаких дополнений к зданию не предлагается
  • Проверка существующих фондов моложе 10 лет
  • Проверка существующего каркаса и распорок стен для конструкций возрастом от 5 до 10 лет
  • По усмотрению проверяющего или строительного инспектора, при необходимости, определить соответствие требованиям технических норм.
Нужно ли мне разрешение на строительство проходов (плоских работ) на моем участке?

Тротуары и проезды, не расположенные на полосе отвода, не требуют разрешения на строительство.Однако имейте в виду, что работа, на которую не выдано разрешение, должна по-прежнему соответствовать Жилищному кодексу и всем другим применимым законам и требованиям Городского кодекса. Раздел ссылочного кода: R105.2 Работа без разрешения , Местные поправки к Международному жилищному кодексу 2015 года.

Нужно ли мне разрешение на снос для удаления камина / дымохода?

Да, для удаления всей конструкции или ее части требуется разрешение на снос согласно LDC 25-11-37.

Какие элементы нужно отображать на плане этажа? Могу я сам нарисовать рисунки?

Планы этажей должны включать (но не ограничиваться ими) следующие элементы: масштаб чертежа, обозначения комнат, размеры стен, высоту потолка, двери и окна, включая размеры или график, расположение детекторов дыма и угарного газа, расположение новых сантехнических приборов с указанием размеров. , расположение поручней / ограждений и площадь помещений.Рисунки можно делать вручную, если они разборчивы, нарисованы в масштабе и содержат информацию, необходимую для проведения ответственной проверки. Полный список требований к подаче можно найти в Руководстве по критериям строительства (BCM) 4.4.0: Требования к подаче жилых помещений.


Вопросы?

Звоните 3-1-1 (в черте города) или 512-974-2000 (вне городской черты).

Назначьте встречу по общим вопросам.

Начиная с января 2021 года, группа по пересмотру жилищного плана будет недоступна по пятницам для запросов по телефону и электронной почте. Чтобы сократить общее время проверки проекта, члены команды будут сосредоточены исключительно на проверке обновлений проекта.

Если для рассмотрения комментариев рецензии необходима встреча, назначьте встречу с назначенным рецензентом.

Мы отвечаем на звонки и электронные письма в порядке поступления.

Добавить комментарий

Ваш адрес email не будет опубликован.